We narrowed to 8,888 results for: tre promoter
-
Plasmid#187457PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (S129D)
Plasmid#185719PurposeAAV expression of GFP and human α-Synuclein with S129D mutation from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVTagsExpressionMutationChanged Ser 129 to AspPromoterhSynAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (S129A)
Plasmid#185718PurposeAAV expression of GFP and human α-Synuclein with S129A mutation from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVTagsExpressionMutationChanged Ser 129 to AlaPromoterhSynAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_MAPK9-P2A-Hygro_Barcode
Plasmid#170238PurposeBarcoded lentiviral vector to express MAPK9 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorInsertMAPK9 (MAPK9 Human)
UseLentiviralTagsV5ExpressionMutationPromoterEF1aAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-AMOT p130∆PPxY2
Plasmid#166712Purposeexpresses AMOT with inactivating mutation in second PPxY motif in mammalian cellsDepositorInsertAngiomotin p130 P262A P263A (AMOT Human)
UseTags2xHAExpressionMammalianMutationchanged proline 262 to alanine, proline 263 to al…PromoterCMV promoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-AMOT p130∆PPxY3
Plasmid#166713Purposeexpresses AMOT with inactivating mutation in third PPxY motif in mammalian cellsDepositorInsertAngiomotin p130 P3072A P308A (AMOT Human)
UseTags2xHAExpressionMammalianMutationchanged proline 307 to alanine, proline 308 to al…PromoterCMV promoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_∆R13–DD-talin1 (1-2299)
Plasmid#166125PurposeFor expression of mouse talin-1 (residues 1-2299) with C-terminal deletion of dimerization domain and R13 (∆R13-DD) in mammalian cells. Contains C-terminal EGFP tag.DepositorInsert∆R13–DD-Talin-1 (Tln1 Mouse)
UseCmv promoterTagsEGFPExpressionMammalianMutationresidues 1-2299, deletion of dimerization domain …PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
UseTagsExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMCh1753_S2F-IMCg_doxy-CMV_mChe-Cdc42E7-E63'UTR
Plasmid#118615Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR (swap) under doxy-inducible CMV promoterDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationPromotertetON CMVAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorInserthNGN2-P2A-PuroR (NEUROG2 Human)
UseLentiviralTagsExpressionMutationPromoterTetOAvailable sinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(T217E)
Plasmid#187024PurposeExpresses EGFP tagged human 2N4R tau (with T217E mutation) in mammalian cells with CMV promoterDepositorInsertMAPT (MAPT Human)
UseTagsEGFPExpressionMammalianMutationChanged Threonine 217 to Glutamic acidPromoterCMVAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(T217A)
Plasmid#187025PurposeExpresses EGFP tagged human 2N4R tau (with T217A mutation) in mammalian cells with CMV promoterDepositorInsertMAPT (MAPT Human)
UseTagsEGFPExpressionMammalianMutationChanged Threonine 217 to AlaninePromoterCMVAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGolt-mCherry / pGolt3-mCherry
Plasmid#73297PurposeVisualization of Dendritic Golgi SatelliteDepositorInsertsER export signal of Scap
ER export signal of Scap
TMD (trans-membrane domain) of Calneuron-2 (Cabp7 Rat)
UseTagsER export and mCherryExpressionMammalianMutationPromoterCMV immediate early promoterAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST p38KTRClover
Plasmid#59152PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGFRdn
Plasmid#80431PurposeExpression of a dominant-negative FGFR1 with a nuclear EGFP reporter in chick embryosDepositorInsertFibroblast growth factor receptor 1 (FGFR1 Chicken)
UseTagsEGFPExpressionMammalianMutationcontains aa 1–425Promoterbeta-actin promoterAvailable sinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaCTD_P2A_Hygro_Barcode
Plasmid#120511PurposeBarcoded lentiviral vector to express MYC deltaCTD in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaCTD (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of carboxy-terminal domainPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaNTD_P2A_Hygro_Barcode
Plasmid#120510PurposeBarcoded lentiviral vector to express MYC deltaNTD in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaNTD (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of amino-terminal domainPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaMBI_P2A_Hygro_Barcode
Plasmid#120504PurposeBarcoded lentiviral vector to express MYC deltaMBI in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaMBI (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of MYC Box I domainPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Synapsin sHRPb-NLG in FSW lentiviral vector
Plasmid#73148PurposeSmall fragment of split HRP fused to the extracellular terminus of NLG1. This is a lentiviral plasmid, but can also be used for transfections. Syanpsin promoter.DepositorInsertsHRPb-NLG (Nlgn1 Synthetic, Mouse)
UseLentiviralTagsV5 tagExpressionMammalianMutationPromoterSynapsinAvailable sinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltab_P2A_Hygro_Barcode
Plasmid#120507PurposeBarcoded lentiviral vector to express MYC deltab in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltab (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of basic motifPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaMBII_P2A_Hygro_Barcode
Plasmid#120505PurposeBarcoded lentiviral vector to express c-MYC deltaMBII in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertc-MYC deltaMBII (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of MYC Box II domainPromoterEF1aAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaLZ_P2A_Hygro_Barcode
Plasmid#120509PurposeBarcoded lentiviral vector to express MYC deltaLZ in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaLZ (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of leucine zipper motifPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaHLH_P2A_Hygro_Barcode
Plasmid#120508PurposeBarcoded lentiviral vector to express MYC deltaHLH in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaHLH (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of helix-loop-helix motifPromoterEF1aAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_v2_Dual_epegRNA_tevopreQ1
Plasmid#187456PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4_v2 optimized epegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R_v2 epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116
Plasmid#123243PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterPGKAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Thr58Ala_P2A_Hygro_Barcode
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralTagsExpressionMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaNLS_P2A_Hygro_Barcode
Plasmid#120506PurposeBarcoded lentiviral vector to express c-MYC deltaNLS in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC H84NLS (MYC Human)
UseLentiviralTagsExpressionMutationDeletion of nuclear localization signal sequencePromoterEF1aAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
Plasmid#187458PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Ser62Ala_P2A_Hygro_Barcode
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralTagsExpressionMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
UseTagsmTurquoise2 and shadowGExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianMutationPromoterEF1aAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(CMVtight-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236278PurposeLentiviral vector that can express doxycycline-inducible hAqp1 with fkbp12 degron in Tet ON mammalian cells. CMVtight promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianMutationPromoterCMVtightAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Grik1-GFP
Plasmid#233645PurposeExpresses GFP in OFF cone bipolar cellsDepositorInsertGrik1 promoter (Grik1 Mouse)
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
UseTagsmTurquoise2 and shadowYExpressionMammalianMutationPromoterCMVAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only