We narrowed to 2,760 results for: FAS
-
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsEGFPExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialPromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA(NcoI/EcoRI)
Plasmid#15405DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutationinsert can be released by digestion with REs NcoI…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationincludes distal fragment of human frataxin promot…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
FXN_Halo_N_allele
Plasmid#178141PurposeDonor vector for endogenous tagging of human FXN at the N-terminus with halotagInsertHalotag (FXN Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p(bhsp68-Cas9)
Plasmid#65959PurposeTribolium basal heat shock promoter driving Cas9DepositorInsertCas9
UseCRISPRTagsnuclear localization sequenceExpressionInsectPromoterbhspAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2,5kb)
Plasmid#14980DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationstart codon for human frataxin gene has been muta…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(1,3kb)
Plasmid#14979DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationstart codon for human frataxin gene has been muta…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(1kb)
Plasmid#14978DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationstart codon for human frataxin gene has been muta…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(I154F)(AA88)-HA
Plasmid#15403DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1, HA, and HISExpressionBacterialMutationcontains cDNA coding sequence for amino acids 88-…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET28(a)-hFX(I154F)-HA
Plasmid#14992DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1, HA, and HISExpressionBacterialMutationcontains cDNA coding sequence for amino acids 88-…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh28
Plasmid#73669PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-BPTF-sh27
Plasmid#73668PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceApril 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
DAXX-myc
Plasmid#1851DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hFrataxin-HA
Plasmid#31895DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
DAXX-myc-his
Plasmid#1852DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpdCas9-VP64
Plasmid#115794PurposeExpresses SpdCas9-Vp64 fusion protein when packaged into AAVDepositorInsertVP64
UseAAVTags3XFLAG and dCas9-VP64ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_1
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_2
Plasmid#102971PurposeSuppression of FXNDepositorInsertshFXN_2 (FXN Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28(a)-hFX-HA
Plasmid#14991DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1, HA, and HISExpressionBacterialMutationcontains cDNA coding sequence for amino acids 88-…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(AA88)-HA
Plasmid#15402DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1, HA, and HISExpressionBacterialMutationcontains cDNA coding sequence for amino acids 88-…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAR127_StrepI_m(KS_MAT)_mouseL_ACP_H8_pET22b
Plasmid#122850PurposeExpresses a designed construct of the condensing part fused to the ACP domain of murine type I fatty acid synthase (FASN) in Escherichia coliDepositorInsertm(KS_MAT)_mouseL_ACP (Fasn Mouse)
TagsHis8 tag and Twin-Strep tagExpressionBacterialMutationwildtypePromoterT7 promoterAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-hFX-HA
Plasmid#14976DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS human Frataxin (myc tag)
Plasmid#11443DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro human Frataxin
Plasmid#11505DepositorAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBabe hygro human Frataxin
Plasmid#11504DepositorAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV14_NHP2L1(15.5kD)
Plasmid#73065Purposeexpression clone for human NHP2L1 (15.5kD) with C-terminal 3xFLAG-tagDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDRIVE-CAG-hFX-HA
Plasmid#14994DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
pAR69_STRI_m(KS_MAT)_H8_pET22b
Plasmid#122849PurposeExpresses the condensing part of murine type I fatty acid synthase (FASN) consisting of the KS and MAT domain in Escherichia coli. N-terminal Twin-Strep tag; C-terminal H8-tag; in pET22b vector.DepositorInsertm(KS_MAT) (Fasn Mouse)
TagsHis8 tag and Twin-Strep tagExpressionBacterialMutationwildtypePromoterT7 promoterAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-hFX(I154F)-HA
Plasmid#14977DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionMammalianMutationchanged isoleucine 154 to phenylalanineAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA
Plasmid#14987DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBabe neo human Frataxin
Plasmid#11503DepositorAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2-bGH
Plasmid#235300PurposeComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p210-ΔFA-FLAG
Plasmid#205625PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p210 isoform b3a2
TagsFLAGExpressionMammalianMutationdeleted FA domainPromoterCMVAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
NF-155 pcDNA3
Plasmid#197290PurposePlasmid expressing an antigen targeting the Plasmid expressing an antigen targeting Neurofascin-155DepositorInsertPan-Neurofascin (extracellular) (Nfasc Rat)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
FBE-Luc
Plasmid#16526DepositorAvailable SinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAcUW21-CqJHE
Plasmid#84213Purposebaculovirus transfer vector containing cqjhe coding sequence from Culex quinquefasiatusDepositorInsertJHE
ExpressionInsectPromoterp10Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
Plasmid#169369PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039653Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0146_Cq-U6-1_2xBbsI-gRNA
Plasmid#169238PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertCq-U6-1_2xBbsI-gRNA
UseCRISPRExpressionInsectPromoterCPIJ039653Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only