We narrowed to 6,963 results for: RAP
-
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBMN FKBP(DD)-YFP
Plasmid#31763DepositorInsertFKBP(DD)-YFP-HA (FKBP1A Human)
UseRetroviralTagsHA and YFPExpressionMutationF36V, L106P on FKBP12PromoterLTRAvailable sinceOct. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgM/λ
Plasmid#61880PurposeExpresses grass pollen allergen Phl p 7 specific human IgM/λ antibody isotype (102.1F10-IgM/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Mu heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV_TRET_Ngn2‐2A‐Ngn1
Plasmid#61471Purpose3rd generation lentiviral vector; TetON promoter driving mouse Ngn2 and Ngn1DepositorUseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG1/λ
Plasmid#50366PurposeExpresses grass pollen allergen Phl p 7 specific human IgG1/λ antibody isotype (102.1F10-IgG1/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 1 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
UseTagsExpressionMammalianMutationPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgE/λ
Plasmid#50365PurposeExpresses grass pollen allergen Phl p 7 specific human IgE/λ antibody isotype (102.1F10-IgE/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human epsilon heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
UseTagsExpressionMammalianMutationPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-EF1.Pro
Plasmid#79488PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human EF1 promoterDepositorInsertEF1 Promoter (EEF1A1 Human, Synthetic)
UseMultisite gateway entry cloneTagsExpressionMutationPromoterEF1 PromoterAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
UseTagsExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available sinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV-IRES_Tomato
Plasmid#107229PurposeTomato expressing plasmidDepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgG2/κ
Plasmid#61884PurposeExpresses HER2/neu receptor specific humanized IgG2/κ antibody isotype (Trastuzumab-IgG2/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 2 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mGreenLantern
Plasmid#164468PurposeCre-dependent EF1a-driven expression of mGreenLantern in animals using AAVDepositorInsertmGreenLantern
UseAAVTagsExpressionMammalianMutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L2…PromoterEF1aAvailable sinceJan. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-dV-IgG1/λ
Plasmid#52214PurposeHuman immunoglobulin gamma 1 antibody expression vector (lambda light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) coloniesDepositorInsertsHuman immunoglobulin gamma 1 constant region
Human immunoglobulin lambda constant region
UseTagsExpressionMammalianMutationDeleted Variable regionPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIG-831_HA-GD2-28z_CAR_TFAP4_Retroviral
Plasmid#207508PurposeThis plasmid can be used to generate retrovirus.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m
Plasmid#123308PurposeExpresses the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based NE sensor GRAB_NE1m
UseAAVTagsExpressionMutationcontains a glycine-to-threonine mutation at posit…PromoterhSynAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-AID-BubR1
Plasmid#47330Purposefor plasmid integration using the Flp-In system. AID at N-terminalDepositorInsertBUB1 mitotic checkpoint serine/threonine kinase B (BUB1B Human)
UseTagsAID and GFPExpressionMammalianMutationsiRNA resistantPromoterAvailable sinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorInsertOmomyc (MYC Human)
UseTagsFLAGExpressionMammalianMutationE57T, E64I, R70Q, R71NPromoterAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.CD19-FMC63.218.CAR-2G
Plasmid#194457PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-CD19 from FMC63 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-CD19 CAR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgG4/κ
Plasmid#61887PurposeExpresses HER2/neu receptor specific humanized IgG4/κ antibody isotype (Trastuzumab-IgG4/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 4 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-KozATG-dL5-2XG4S-mCer3
Plasmid#73207PurposeExpresses dL5(E52D)-mCer3 fusion protein in cytosol of mammalian cells, penetrates nucleus. (MBIC5, dL5**, FAP)DepositorInsertKozATG-dL5-2XG4S-mCer3
UseTagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA2
Plasmid#220578PurposeTo inducibly knockdown CCND1 expressionDepositorInsertCCND1 shRNA2 (CCND1 Human)
UseLentiviralTagsExpressionMutationPromoterTRE3G (TetOP) promoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1136J
Plasmid#153023PurposeExpress His-MBP-TEV-CasRx recombinant proteinDepositorInsertCasRx
UseTagsHis-MBP-TEVExpressionBacterialMutationPromoterT7Available sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-M80-F2-IgG1/κ
Plasmid#50383PurposeExpresses human IgG1/κ antibody isotype with unknown specificity. Useful vector for cloning of human antibodies with kappa light chainDepositorInsertshuman Gamma 1 heavy chain expression cassette with unknown specificity
human Kappa light chain expression cassette with unknown specificity
UseTagsExpressionMammalianMutationPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceJan. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgA1/κ
Plasmid#61888PurposeExpresses HER2/neu receptor specific humanized IgA1/κ antibody isotype (Trastuzumab-IgA1/κ)DepositorInsertsHER2/neu receptor specific humanized Alpha 1 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC129: pAAV.CMV-CasRx mCh
Plasmid#203442PurposePlasmid expressing active RfxCas13d with mCherry reporter for investigating CasRx activityDepositorInsertRfxCas13d-T2A-mCherry
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgM/κ
Plasmid#61881PurposeExpresses HER2/neu receptor specific humanized IgM/κ antibody isotype (Trastuzumab-IgM/κ)DepositorInsertsHER2/neu receptor specific humanized Mu heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)_rPD-L1nb
Plasmid#226715PurposeHeterologous expression and purification of recombinant PD-L1 nanobody (rPD-L1nb)DepositorInsertRecombinant PD-L1 nanobody
UseTagsHA tag and Histidine tagExpressionBacterialMutationPromoterT7Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgA2/κ
Plasmid#61889PurposeExpresses HER2/neu receptor specific humanized IgA2/κ antibody isotype (Trastuzumab-IgA2/κ)DepositorInsertsHER2/neu receptor specific humanized Alpha 2 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
UseTagsExpressionMammalianMutationPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120A
Plasmid#123115PurposeExpresses EGFP-LC3B G120A in mammalian cells. Negative control fluorescent reporter, unable to localize to autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseTagsEGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…TagsExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only