We narrowed to 12,235 results for: Hal
-
Plasmid#185040Purpose400 nt l31 promoter region, l31 5'UTR U58C and U70C, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationU58C and U70C of rpmE of 5'UTR, Only first 9…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR017-L31-sfGFP
Plasmid#185024Purpose400 nt l31 promoter region, l31 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationOnly first 90 nt of rpmE coding presentAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR039
Plasmid#185025Purpose400 nt l31 promoter region, l31 5'UTR with nt. 1-31 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 1-31 deleted from rpmE 5'UTR, On…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR040
Plasmid#185026Purpose400 nt l31 promoter region, l31 5'UTR with nt. 35-46 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 35-46 deleted from rpmE 5'UTR, O…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR041
Plasmid#185027Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-54 & 76-86 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 47-54 & 76-86 deleted from rpmE …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-NSD3
Plasmid#221297PurposeExpression of NSD3 (pLxIS) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-ZBTB44
Plasmid#221299PurposeExpression of ZBTB44 (pLxIS) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-H3(pLxIS-PLPLR)
Plasmid#221287PurposeExpression of H3 (pLxIS-PLPLR) in mammalian cells by retroviral transductionDepositorInsertH3 (pLxIS-PLPLR) (H3 Synthetic)
UseRetroviralTags3xFLAG-4xFKBPMutationK to Q mutations made to inhibit NLSAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(pLxIS)
Plasmid#221261PurposeExpression of TASL pLxIS (266-298) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(Cterm)
Plasmid#221262PurposeExpression of TASL Cterm (102-298) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-123)
Plasmid#221252PurposeExpression of TRIF truncation 6 (124-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-143)
Plasmid#221253PurposeExpression of TRIF truncation 7 (144-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-163)
Plasmid#221254PurposeExpression of TRIF truncation 8 (164-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-43)
Plasmid#221248PurposeExpression of TRIF truncation 2 (44-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-63)
Plasmid#221249PurposeExpression of TRIF truncation 3 (64-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-83)
Plasmid#221250PurposeExpression of TRIF truncation 4 (84-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-103)
Plasmid#221251PurposeExpression of TRIF truncation 5 (104-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-23)
Plasmid#221247PurposeExpression of TRIF truncation 1 (24-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-K22R
Plasmid#220293Purposemammalian expression of Bcl-2-K22R tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-G101V
Plasmid#220295Purposemammalian expression of Bcl-2-G101V tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-K17R
Plasmid#220292Purposemammalian expression of Bcl-2-K17R tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH1
Plasmid#220297Purposemammalian expression of Bcl-2-ΔBH1 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-F104C
Plasmid#220296Purposemammalian expression of Bcl-2-F104C tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH3
Plasmid#220299Purposemammalian expression of Bcl-2-ΔBH3 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH2
Plasmid#220298Purposemammalian expression of Bcl-2-ΔBH2 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-T132L
Plasmid#220303Purposemammalian expression of Bcl-2-T132L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-A131L
Plasmid#220302Purposemammalian expression of Bcl-2-A131L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-G128L
Plasmid#220301Purposemammalian expression of Bcl-2-G128L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1996
Plasmid#217825PurposeExpresses putative photoreceptor SA-phr1 from S. alba. This gene shows high homology to the phr genes in prokaryotes.DepositorInsertSA-phr1
TagsMaltose-binding proteinExpressionBacterialAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-a2-GEMS(PLCG)
Plasmid#209114PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-a2-GEMS (PLCG)DepositorInsertA-a2-GEMS(PLCG)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 N352A HA
Plasmid#208365PurposeExtracellular HA-tagged Fzd6 N352A (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 S354I HA
Plasmid#208364PurposeExtracellular HA-tagged Fzd6 S354I (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6HA
Plasmid#208363PurposeExtracellular HA-tagged Fzd6 (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only