We narrowed to 16,891 results for: Por
-
Plasmid#34924PurposeExpresses a fusion between the Lck domain and cytosolic GCaMP5G. This construct targets GCaMP5G to the plasma membraneDepositorInsertLck-GCaMP5G
UseTagsExpressionMammalianMutationPlasmid contains N-terminal 26 amino acid membran…PromoterCMVAvailable SinceFeb. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A4_STOP
Plasmid#161148PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC1A5_STOP
Plasmid#161140PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…TagsExpressionMammalianMutationPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_MFSD9
Plasmid#131894PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MFSD8_STOP
Plasmid#161048PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_FLVCR1
Plasmid#131892PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Syn-miRFP
Plasmid#108416PurposeMonomeric near-infrared fluorescent protein miRFP in mammalian-expressing AAV production plasmidDepositorInsertmiRFP
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorInserthuman ATP13A2 (ATP13A2 Human)
UseLentiviralTagsExpressionMutationD508N , D962NPromoterCMVAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
iGFP-gamma-actin
Plasmid#231554PurposeMammalian expression of human gamma actin fused intramolecularly to monomeric superfolder GFPDepositorInsertACTG1 (ACTG1 Human)
UseTagsmsfGFP (intramolecular)ExpressionMammalianMutationPromoterCMVAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A2_STOP
Plasmid#161442PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC6A4_STOP
Plasmid#161338PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_MFSD2A
Plasmid#131893PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLEX-PGK-ANXA11-mCerulean
Plasmid#164214PurposepLEX lentivirus backbone expresses mCerulean tagged ANXA11 under PGK promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 D962N
Plasmid#171821Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 D962NDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2
Plasmid#115892PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC17A5_STOP
Plasmid#161102PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PMXS-GOT1
Plasmid#72872PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.DepositorInsertGOT1 (GOT1 Human)
UseRetroviralTagsExpressionMammalianMutationsgRNA resistant human GOT1, 7 silent mutations c1…PromoterAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIH-mRuby2-BAK
Plasmid#111627PurposeFluorescent fusion protein used to visualise mouse BAK, with hygromycin selectionDepositorAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd-Cas9n-UGI-NLS
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MFSD2B_STOP
Plasmid#161435PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_MFSD10
Plasmid#131890PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLCO4A1_STOP
Plasmid#161402PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_MFSD8
Plasmid#131882PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC4A4_STOP
Plasmid#161426PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC52A3
Plasmid#132181PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MTCH2_STOP
Plasmid#161120PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A37_STOP
Plasmid#161207PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC38A2
Plasmid#132059PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceNov. 19, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MAGT1
Plasmid#132302PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-ANKH
Plasmid#132278PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MFSD5_STOP
Plasmid#161107PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEX-PGK-LAMP1-EYFP
Plasmid#164215PurposepLEX lentivirus backbone expresses EYFP tagged LAMP1 under PGK promoterDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A22_STOP
Plasmid#161217PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV-NanoLuc-BRAF-CAT
Plasmid#194772PurposeMammalian expression construct encoding the BRAF catalytic (CAT) domain (AA 435-766) with an N-terminal NanoLuc tag.DepositorInsertBRAF catalytic (CAT) domain (AA 435-766) (BRAF Human)
UseTagsNanoLucExpressionMammalianMutationPromoterCMV51Available SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-BRAF-REG-Halo
Plasmid#194771PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
UseTagsHaloTagExpressionMammalianMutationPromoterCMV51Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC3A1_STOP
Plasmid#161367PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLCO1B3_STOP
Plasmid#161366PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A19_STOP
Plasmid#161429PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZ:F3-CAGGS GPHTK-F
Plasmid#112666PurposeGenome engineering donor vector for creating master cell lines suitable for FLPe recombinase-mediated cassette exchange (RMCE) in the AAVS1 locusDepositorInserteGFP
UseGene targeting vector for integration at the s1 s…TagsExpressionMammalianMutationPromoterCAGAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC38A2_STOP
Plasmid#161225PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC35A2_STOP
Plasmid#161313PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-FLVCR2_STOP
Plasmid#161070PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pmiRFP-alpha-Tubulin-19-C
Plasmid#108413PurposeAlpha-tubulin fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ P TetON-3XFLAG-tdT CAGG-m2rtTA v2
Plasmid#112668PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows inducible expression of your protein of interest.DepositorInserttdT
UseAAV; Donor plasmid for recombinase-mediated casse…TagsExpressionMammalianMutationPromoterAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TUSC3_STOP
Plasmid#161470PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC4A11_STOP
Plasmid#161358PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoExpressionMutationPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only