We narrowed to 5,821 results for: ATC
-
Plasmid#163791PurposeThe plasmid expresses human codon-optimized BlatCas9, gRNA expression elements and blasticidin resistence gene.DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAM/CBA-eGFP-miRaSyn(mouse)x3-WPRE-bGHpA
Plasmid#194248PurposeExpresses 3 miRNAs targeting mouse alpha-SynucleinDepositorInsertmiRaSynuclein(mouse) (Snca Mouse)
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR1
Plasmid#183289PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR1 geneDepositorInsertFGFR1
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pTBL3331 MTK234-TetO-AtoBpegRNA
Plasmid#226668PurposeMTK234 part containing tet-inducible variant of the hU6 promoter driving an A to B pegRNADepositorInserthU6-TetO-AtoBpegRNA
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6-TetOAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pSL7 SMR1791
Plasmid#28030DepositorUseTagsExpressionBacterialMutationPromoterAvailable sinceApril 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-SIINFEKL
Plasmid#174601Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the SIINFEKL epitopeDepositorInsertmembrane bound CD19, SIINFEKL (ovalbumin epitope)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-LLO-mPMEL
Plasmid#174608Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the murine hPMEL epitopeDepositorInsertmembrane GFP fused to LLO and mouse PMEL antigen
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trCD45
Plasmid#203753PurposeEncodes the transmembrane domain from CD45 with mEos3.2 fused on the N terminus. Used as a fluorescent plasma membrane probe.DepositorInserttrCD45 (PTPRC Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
trPAGmEos3.2
Plasmid#203752PurposeEncodes the transmembrane domain from PAG/CSK, including its 2 palmitoylation sites, with mEos3.2 fused on the C terminus. Used as a fluorescent plasma membrane probe.DepositorInserttrPAG (PAG1 Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro human lipin 1-1 shRNA
Plasmid#32019DepositorInsertlipin1 shRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC1765
Plasmid#141346PurposeMini plasmid containing minimal sequences for amplification in bacteria and two BbvCI nicking sites for introduction of modified DNA through annealing and ligation (e.g. mismatch, DNA lesions, flap).DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
UseTagsExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable sinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRIS
Plasmid#120424PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3, IS150
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterconstitutiveAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
sh-Myocardin
Plasmid#100768Purposeexpression of shRNA targeting MYOCDDepositorInsertsh-Myocardin
UseRNAiTagsExpressionMutationPromoterH1Available sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pW401-lenti-sg1-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189950PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg1-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #1
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-LLO-hPMEL
Plasmid#174607Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the human hPMEL epitopeDepositorInsertexpresses palmitoylated GFP w/C-term fusion of the LLO190 epitope and human hPMEL epitope
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
trLATmEos3.2
Plasmid#203745PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Used as a fluorescent plasma membrane probe.DepositorInserttrLAT (LAT Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Circular 100,50 (RAB7A)
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-super-IL-2
Plasmid#174599PurposeExpresses extracellular domain of human IL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F) developed by the Garcia LabDepositorInsertextracellular domain of huIL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPbcsx28
Plasmid#89909PurposeExpresses csx28 from P. buccae ATCC 33574 in bacteria. Expression driven from the Lac promoterDepositorInsertcsx28
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GPI
Plasmid#203759PurposeEncodes the fluorescent protein mEos3.2 followed by the C-terminal sequence derived from CD58 encoding a GPI-attachment signal. Used as a fluorescent plasma membrane probe.DepositorInsertCD58 c-term (CD58 Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseTagsExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mIL15-IL12rb1-sushi-il12rb2
Plasmid#174606PurposeExpresses a constitutively activated murine IL-12 receptor tagged with extracellular myc and flag tagsDepositorInsertExpresses a constitutively activated murine IL-12 receptor tagged with extracellular myc and flag tags
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBZcsx27
Plasmid#89900PurposeExpresses csx27 from B. zoohelcum ATCC 43767 in bacteria. Expression driven from the Lac promoterDepositorInsertcsx27
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionTagsExpressionMutationPromoterAvailable sinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgLacZs
Plasmid#171185PurposeExpresses sgRNADepositorInserthU6-sgLacZ1-hU6-sgLacZ2
UseAAVTagsmCherryExpressionMutationPromoterU6, hSynAvailable sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mtGFP-llo-lama4-alg8
Plasmid#174605Purposeexpresses palmytoylated GFP with a C terminal fusion of the LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 and Lama4DepositorInsertpalmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Myocardin
Plasmid#100769PurposeLentiviral expression of shRNA targeting MYOCDDepositorInsertLenti-sh-Myocardin
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM BRD7 sh1
Plasmid#41927DepositorInsertBRD7 (BRD7 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only