We narrowed to 2,827 results for: RELA
-
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Usp5
Plasmid#174873PurposeCRISPR vector for generating Usp5 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Usp5 (Usp5 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Wnk1
Plasmid#174874PurposeCRISPR vector for generating Wnk1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Wnk1 (Wnk1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
mTln1-F2-pET151
Plasmid#177870PurposeExpresses mouse Talin 1 F2 domain in bacterial cellsDepositorInsertmouse Talin 1 F2 domain (Tln1 Mouse)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
mTln1-F2F3-pET151
Plasmid#177877PurposeExpresses mouse Talin 1 F2F3 domains in bacterial cellsDepositorInsertmouse Talin 1 F2F3 domain (Tln1 Mouse)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BMP10 N67Q N131Q D4G (S2-2)
Plasmid#184622Purposefor transfection into S2 cells and expression of BMP10 proteinDepositorInsertBMP10 (BMP10 Human)
Tags8x His - streptavidin binding peptideExpressionInsectMutationN67Q, N131Q, ARIRR(312-316) replaced with GAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD400
Plasmid#163107PurposeExpression of eYFP_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_eYFP_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD403
Plasmid#163108PurposeExpression of mScarlet-I_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmScarlet-I_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD128
Plasmid#163097PurposeExpression of mTurquoise2_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmTurquoise2_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD129
Plasmid#163098PurposeExpression of mEos3.2_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmEos3.2_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD188
Plasmid#163099PurposeExpression of mEos3.2_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mEos3.2_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD198
Plasmid#163101PurposeExpression of mEGFP_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmEGFP_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD396
Plasmid#163103PurposeExpression of eYFP_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInserteYFP_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD438
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim Actin MCH Puro (CAMP)
Plasmid#104446PurposeExpresses mCherry under endogenous actin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope. Puromycin resistant.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoteractinAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG-WPRE
Plasmid#127869PurposepAAV plasmid expressing an NOS-IN133.3xFLAG fusion protein under the hSyn promoterDepositorAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
PME-1_R369D mutant
Plasmid#119294PurposeMammalian overexpression of StrepII-tagged full length PPME1 with mutation in the PP2Ac binding motifDepositorAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-YFP-566CT
Plasmid#41677DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-CFP-571CT
Plasmid#41680DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-YFP-571CT
Plasmid#41679DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-CFP-566CT
Plasmid#41678DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E,NoCys)
Plasmid#66875PurposeExpresses a cysteine-free version of pET30Xa-SBL1(160E) (4Cys to Ser) with N-term HistagDepositorInsertsoybean lipoxygenase-1 (S160E) with all Cys to Ser mutations
TagsHistagExpressionBacterialMutationS160E; changed 4 (all) cysteines to serinePromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry-miniSOG-H2B-C-10
Plasmid#57789PurposeLocalization: Nucleus/Histones, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertH2B (H2BC11 Human)
TagsPA-mCherry-miniSOGExpressionMammalianMutationD26G and V119I in H2BPromoterCMVAvailable SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S620T
Plasmid#53059PurposeExpresses alpha subunit of S620T hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 620 to ThreoninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1(+)mGAT1CFP45
Plasmid#41676DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1YFP45
Plasmid#41675DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-AbrR683AN795A-HisC
Plasmid#32510DepositorAvailable SinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Mito-7
Plasmid#57773PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS2-TEV-Twin-Strep
Plasmid#202529PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 2 (SMS2) in mammalian cellDepositorInsertSGMS2 (SGMS2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TGA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable si…ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9-6XMS2
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralPromoterCMVAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHis-BRD4 BD1
Plasmid#196544PurposeExpression of BRD4 Bromodomain (BD1) in E.coliDepositorAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDragon-Ctgf
Plasmid#155015PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to connective tissue growth factor in the presence of Cre and (r)tTA activity.DepositorAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2BmGreenLantern
Plasmid#177332PurposeTo express a bright monomeric green FP to label eucaryotic cell nuclei. To be used in clearing and other fluorescent microscope methods.DepositorInsertH2B (Hist1h2bq Rat)
UseAAVTagsmGreenLanternExpressionMammalianMutationThis fusion protein was optimized to the Human co…PromoterCAGAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VP64-Puro
Plasmid#99371Purpose3rd generation lenti vector encoding dCas9-VP64 with 2A puromycin resistance marker (EF1a-dCas9-VP64-T2A-Puro-WPRE)DepositorInsertdCas9-VP64-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-ClopHensorN-WPRE-HGHpA
Plasmid#193728PurposeCre-activated AAV expression of ClopHensorN for measuring intracellular chloride and pH in genetically-defined cell typesDepositorInsertClopHensorN
UseAAVTagsStrep-II (N terminal on insert)ExpressionMammalianPromoterEF1aAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMYH9-D1424H-FLAG
Plasmid#183513PurposeGateway expression vector encoding D1424H mutant MYH9 cDNA, with N-terminal Flag tag. For mammalian expression.DepositorInsertMYH9 (MYH9 Human)
TagsFLAGExpressionMammalianMutationchanged Aspartic acid 1424 to HistidinePromoterCMVAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only