173,273 results
-
Plasmid#242432PurposeThe pERV3 vector expresses both VgEcR and RXR from a dicistronic mRNA transcribed under the control of the CMV promoter. This is achieved by inserting an internal ribosome entry site (IRES) between thDepositorInsertVgEcR and RXR
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-LifeCamp
Plasmid#251724PurposeExpression of calcium lifetime sensor LifeCamp under hSyn promoter in pAAV backboneDepositorInsertLifeCamp
UseAAVExpressionMammalianAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX302 BMP2-V5 puro
Plasmid#246525PurposeLentiviral expression vector for BMP2 with V5 tagDepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hisM5RT
Plasmid#216672PurposeExpresses his-tagged Mut5 reverse transcriptase in E. coli hostsDepositorInsertthermostable M-MuLV reverse transcriptase variants
Tagshis-tagExpressionBacterialPromoterT7Available SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA388
Plasmid#245311PurposeFragmid fragment: (N' terminus) TadA-CDdDepositorInsertTadA-CDd
ExpressionBacterialMutationNoneAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-RBAP46/RBBP7
Plasmid#109210PurposeEncodes human full-length RBBP7 (aka RBAP46) to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-SAP30
Plasmid#109212PurposeEncodes human full-length SAP30 to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIDTsmart-RC2-KO-delVP1-VP1-588TAG
Plasmid#240123PurposeExpress AAV2-KO (R585A,R588A) capsid with ncAA mutant at site 588 of VP1DepositorInsertsRC2-DelVP1-R585,588A
VP1-588-TAG
UseAAVExpressionMammalianAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK-BB2 [Backbone_RK2-KanR-TetR_PartTypeBB]
Plasmid#229388PurposeXanthoMoClo Golden Gate Backbone Plasmid, contains Backbone_RK2-KanR-TetR_PartTypeBB and an sfGFP dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK084 [CDS_mRFP_PartType9]
Plasmid#229321PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains CDS_mRFP_PartType9DepositorInsertmRFP
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRV∆L-5Flpo
Plasmid#182965PurposeThe 3rd generation of rabies vector expressing Flpo recombinaseDepositorInsertFlpo recombinase
UseRabiesAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-RAX-Brd 427
Plasmid#219343PurposeTranscription factor RAX with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
HisMS2_VLP_FluB
Plasmid#175956PurposeGeneration of MS2 Virus-Like Particles packaged with the sequence for the Influenza B NSP 1 protein [B/Colorado/06/2017]DepositorInsertNEP gene
ExpressionBacterialPromoterT7Available SinceSept. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-hSyn-IvfChr-citrine-KV2.1
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_luxR-PLuxB
Plasmid#204073PurposeType 0 promoter partDepositorInsertluxR-PLuxB repressor and PLuxB 3OC6-AHL-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_rhaS-PRhaB
Plasmid#204076PurposeType 0 promoter partDepositorInsertrhaS activator and PRhaB rhamnose-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSrtA-MT3
Plasmid#200305PurposeBacterial expression plasmids for self cleavable sortase mediated purification of recombinant MT3. Contains His-tag, SUMO-tag, LPETG sortase recognition motif and eSrtADepositorAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 R236A/L263A
Plasmid#51589Purposeexpresses RNAiR myc-tagged Rem2 non-Ca channel interactingDepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationR236A and L263A; silent mutations at shRNA 1 and …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNORg10
Plasmid#249340PurposeMediterraneibacter gnavus - Escherichia coli shuttle vector with catP selection markerDepositorTypeEmpty backboneUseE. coli - r. gnavus shuttle vectorAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-mCherry-NLS
Plasmid#194049PurposeTransient expression of mCherry-NLS in plant cell (Nucleus)DepositorInsertmCherry
TagsSV40 (Nuclear localization signal)ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iATPSnFR2.A95K.tdTomato
Plasmid#248072PurposeiATPSnFR2.A95K variant with non-responsive tdTomatoDepositorInsertiATPSnFR2.A95K.tdTomato
UseAAVMutationA95KAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
phage-cmv-cfp-24xms2
Plasmid#40651DepositorInsertCFP-24xMBS
UseLentiviralTagsCFPExpressionMammalianPromoterCMVAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1WT
Plasmid#230915PurposeExpression of human COL1A1 promoter and testing the promoter activity with luciferase assay.DepositorInsertHuman COL1A1 promoter (COL1A1 Human)
UseLuciferaseTagsluciferase - Luc2pExpressionBacterial and MammalianPromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-21a(+)-AK1-His
Plasmid#118977PurposeBacterial expression plasmid for Adenylate kinase isoenzyme 1DepositorInsertadenylate kinase isoenzyme 1 AK1 (AK1 Chicken)
Tags6x-HisExpressionBacterialPromoterT7 promoterAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianPromoterEF1AAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only