We narrowed to 8,814 results for: CAG
-
Plasmid#90657Purpose3rd generation lentiviral gRNA plasmid targeting human DSN1DepositorInsertDSN1 (Guide Designation C12.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_1
Plasmid#86318PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi1
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorInsertATF7IP (ATF7IP Human)
UseRNAiTagsExpressionMammalianMutationPromoterU6Available sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_2
Plasmid#36375DepositorInsertMBD4 (MBD4 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutA
Plasmid#13498DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseTagsExpressionMutationcontains 3 tandem copies of the following sequenc…PromoterAvailable sinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutB
Plasmid#13499DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseTagsExpressionMutationcontains 3 tandem copies of the following sequenc…PromoterAvailable sinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAV10.K3.loxP
Plasmid#63202PurposepCACS backbone (Amp), SpHIS5, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into YKL162C-A (NotI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pAV10.K6.loxP
Plasmid#63203PurposepCACS backbone (Amp), KlURA3, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into YKL162C-A (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pAV10.K5.loxP
Plasmid#63204PurposepCACS backbone (Amp), LEU2, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into YKL162C-A (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pAV10.HO3.loxP
Plasmid#63205PurposepCACS backbone (Amp), SpHIS5, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into HO locus (NotI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pAV10.HO6
Plasmid#63211PurposepCACS backbone (Amp), KlURA3, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. Integration into HO locus (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Δ18 B.1.1.529
Plasmid#179907PurposeEncodes SARS-CoV-2 B.1.1.529 Spike Protein lacking 18 C-terminal amino acids for pseudovirus productionDepositorInsertSARS-CoV-2 B.1.1.529 Spike truncated to remove 18 amino acids (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationA67V; Δ69-70; T95I; G142D; Δ143-145; N211I; Δ212;…PromoterCAGAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-HygR
Plasmid#118153PurposeSpCas9 expression vectorDepositorInserthSpCas9-T2A-HygR
UseCRISPRTags3XFLAGExpressionMammalianMutationPromoterCAG and U6Available sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai140 (TIT2L-GFP-ICL-tTA2) targeting vector
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterPGK, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorInsertGFP
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaAi9L-U6-SaAi9R
Plasmid#78604PurposeAAV vector containing gRNAs (for SaCas9) targeting Ai9 stop cassetteDepositorInsertgRNAs for SaCas9 targeting Ai9 locus
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorInsertSpCas9(D10A)-P2A-EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149358)
Plasmid#77052Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlatTET-gRNA2
Plasmid#82559PurposeAll in one vector which contains Cas9 peptide array (linker length: 22aa), antibody-sfGFP-TET1CD, and gRNA expression system.DepositorInsertdCas9-5xPlat2AflD-P2A-scFvGCN4sfGFPTET1CD
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
GLuc-FLAG-CB1
Plasmid#158066PurposeMembrane expression detection of Cannabinoid receptor 1DepositorInsertCB1 (CNR1 Human)
UseAAVTagsGaussia LuciferaseExpressionMammalianMutationcontains 4Kb of 3' UTRPromoterpCAGAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #2
Plasmid#68877PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiTagsExpressionMammalianMutationPromoterH1Available sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only