We narrowed to 11,686 results for: nts
-
Plasmid#224439PurposeRep/Cap plasmid for the production of MyoAAV 1E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDTMSK insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP NOVA2 op
Plasmid#224354PurposeExpress GFP-tagged human NOVA2 (codon optimized)DepositorInsertNOVA2 (NOVA2 Human)
TagseGFPExpressionMammalianMutationcodon optimized for expression in human cellsPromoterCMV and T7Available SinceSept. 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pISV-CRISPR/Cas9PGmUbi
Plasmid#209189PurposeExpression of Cas9 in the model legume Medicago truncatula, Gmubi promoter (PGmubi), DsRed and Basta selectionDepositorInsertsCas9
DsRed(deltaB)
TagsNLSExpressionPlantMutationmissing BsaI site and plant-codon optimized with …PromoterCaMV 35S and GmUbi from Glycine max (L.) Merr. cv…Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:TV:Tnos (GB2048)
Plasmid#160627PurposeTU for the constitutive expression of Ms2 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-MS2:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE30-roGFP1-iE
Plasmid#83312PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertroGFP1-iE
Tags6xHISExpressionBacterialMutationro1(C48S/S147C/Q204C) plus X insertion, iE betwe…PromoterT5Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SLC30A10-E25A
Plasmid#82345PurposeExpresses FLAG-tagged SLC30A10-E25A in mammalian cellsDepositorAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282C/EBP mut-LUC
Plasmid#46868Purposemurine 24p3 minimal promoter with C/EBP mutation k as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationCEBP site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAR013 Lenti pEF-dEnAsCas12a-NLS-VP64-3XHA-T2A-BSD
Plasmid#195547PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-VP64-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GST-FBW7 alpha
Plasmid#197456PurposeThe plasmid expresses GST-tagged FBW7 human isoform 1. Used for in vitro translation of FBW7alpha.DepositorInsertFBW7 (FBXW7 Human)
UseIn vitro translationTagsGSTExpressionBacterialMutationSee depositor comments belowPromoterT7Available SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_GLP1R-V2R-NTEV-TCS-GV-2xHA
Plasmid#194380PurposeSplit TEV assaysDepositorInsertGLP1R-V2R-NTEV-TCS-GV-2xHA (GLP1R Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEP-Nanoluc-cyOFP1
Plasmid#141082Purposeprototype of the bioluminescent reporter pHLuc, for detecting extracellular pH changes in tumor acidosisDepositorInsertSEP-Nanoluc-cyOFP1
UseLentiviralMutationDeletion of amino acids DISGG from positions 673 …PromoterEF1αAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1-plus
Plasmid#126775PurposeExpression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1.DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
ICMAB - pET22b T7 EncFtn Mms6
Plasmid#225538PurposeConstruction of intracellular magnetite accumulating bacterial systems.DepositorInsertsIron binding protein
Ferroxidase
Material binding peptite
Iron transporter protein
TagsnoExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-JFRC59-13XLexAop2-IVS-Syn21-RSET-jGCaMP8m-p10
Plasmid#218863PurposeLexA activated transgene expression of ultrafast protein calcium sensor under the hsp70 promoter in D. melanogasterDepositorInsertRSET-jGCaMP8m
Tags6xHis-T7 gene 10 leader-Xpress epitope-Enterokina…ExpressionInsectMutationA25G F286YPromoterhsp70Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-20XUAS-IVS-Syn21-RSET-jGCaMP8f-p10
Plasmid#218866PurposeGal4 activated transgene expression of ultrafast protein calcium sensor under the hsp70 promoter in D. melanogasterDepositorInsertRSET-jGCaMP8f
Tags6xHis-T7 gene 10 leader-Xpress epitope-Enterokina…ExpressionInsectMutationQ315LPromoterhsp70Available SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK341
Plasmid#192640PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpRY
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dSpRY has s…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_R248W+P278A
Plasmid#183115PurposeExpresses flag-tagged p53 with both R248W and P278A mutations in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged proline 278 to alanine and arginine 248 t…PromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only