We narrowed to 20,245 results for: ACE;
-
Plasmid#195720PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#6 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F15
Plasmid#195729PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#15 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F17
Plasmid#195731PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#17 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F19
Plasmid#195733PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#19 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F2
Plasmid#195716PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#2 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F11
Plasmid#195725PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#11 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F16
Plasmid#195730PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#16 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F18
Plasmid#195732PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#18 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F1
Plasmid#195715PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#1 of a 24 fragment split in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F9
Plasmid#195723PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#9 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F23
Plasmid#195737PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#23 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F21
Plasmid#195735PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#21 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21a Lm-iPGM
Plasmid#180242PurposeBacterial expression plasmid for production of recombinant Leishmania mexicana iPGM His10DepositorInsertLeishmania mexicana iPGM-10His
UseTagsHisExpressionBacterialMutationPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Mp-iPGM
Plasmid#180243PurposeBacterial expression plasmid for production of recombinant Mycoplasma pneumoniae iPGM His10DepositorInsertMycoplasma pneumoniae iPGM-10His
UseTagsHisExpressionBacterialMutationPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Sa-iPGM-bio
Plasmid#179523PurposeExpresses S. aureus iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertS. aureus iPGM bio-6His
UseTagsHis tag and biotinylation sequenceExpressionBacterialMutationPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Mo-iPGM-bio
Plasmid#179614PurposeExpresses M. orale iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertM. orale iPGM bio-6His
UseTagsHis tag and biotinylation sequenceExpressionBacterialMutationPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Hp-iPGM-bio
Plasmid#179615PurposeExpresses H. pylori iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertH. pylori iPGM bio-6His
UseTagsHis tag and biotinylation sequenceExpressionBacterialMutationPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_PARRC_150-189 (pBS0658)
Plasmid#185201PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_150-189. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC_150-189
UseTagsExpressionMammalianMutationPromoterAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
UseTagsExpressionMammalianMutationA234GPromoterAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_93-127 (pBS0735)
Plasmid#185231PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_93-127. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_93-127
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_ANDDA_21-367 (pBS0742)
Plasmid#185234PurposeFor the mammalian expression of the Chinese giant salamander protein APOA4_ANDDA_21-367. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_ANDDA_21-367
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q7JLY3_CAEEL_48-124 (pBS0738)
Plasmid#185232PurposeFor the mammalian expression of the C. elegans protein Q7JLY3_CAEEL_48-124. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ7JLY3_CAEEL_48-124
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
UseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only