We narrowed to 4,936 results for: AAT
-
Plasmid#77754Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PRKG1 gRNA (BRDN0001146382)
Plasmid#77004Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HKDC1 gRNA (BRDN0001148023)
Plasmid#76830Purpose3rd generation lentiviral gRNA plasmid targeting human HKDC1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCM2(413-438)_pHisSUMO(K0)
Plasmid#224065PurposeBacterial expression of the C-terminal helix of CCM2 (residues 413-438) fused to an N-terminal hexa-histidine tag and SUMO(K0) [all lysines in SUMO mutated to arginines]. HRV-3C cleavage siteDepositorAvailable SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mito-CCM2-mScarlet-I
Plasmid#208886PurposeExpress mScarlet-I-CCM2 targeted to the mitochondria in mammalian cells.DepositorInsertCCM2 (CCM2 Human)
TagsmScarlet-IExpressionMammalianMutationCCM2 targeted to the mitonchondriaAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LTK gRNA (BRDN0001145095)
Plasmid#77597Purpose3rd generation lentiviral gRNA plasmid targeting human LTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146383)
Plasmid#76329Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL4 gRNA (BRDN0001149476)
Plasmid#76108Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STKLD1 gRNA (BRDN0001148566)
Plasmid#75812Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDC42BPA gRNA (BRDN0001147767)
Plasmid#75748Purpose3rd generation lentiviral gRNA plasmid targeting human CDC42BPADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-TRE-V5-TurboID-linker-T2A-GR-bGH polyA > mPGK-BlastR-SV40 polyA
Plasmid#218910PurposePiggyBac transpositionDepositorInsertV5-TurboID-T2A-huGR/BlastR (NR3C1 Human)
ExpressionMammalianMutation2363G>C and 4155C>T and 4729T>G and 4731…Available SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC1A5
Plasmid#131974PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC1A5 (SLC1A5 Human)
ExpressionMammalianAvailable SinceOct. 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDEST-ERBB3-v2
Plasmid#154894PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB2-v1
Plasmid#154901PurposeExpresses ERBB2 fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A2_STOP
Plasmid#161067PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A2 (SLC1A2 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXS-IRES-Blast HA-GPAT4
Plasmid#173168PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4DepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB2-v2
Plasmid#154895PurposeExpresses ERBB2 (a.k.a HER2) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSET OCaMP
Plasmid#224932PurposeExpresses OCaMP, an orange calcium indicator, in bacteria. Contains T7 promoter and RSET leader sequence peptide (His tag, T7 leader, Xpress epitope)DepositorInsertOCaMP
Tags6xHis, RSET peptide, and Xpress tagExpressionBacterialPromoterT7Available SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001145987)
Plasmid#77773Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC38A4_STOP
Plasmid#161296PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC38A4 (SLC38A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC36A1_STOP
Plasmid#161250PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC36A1 (SLC36A1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC1A1_STOP
Plasmid#161044PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A1 (SLC1A1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC5A4_STOP
Plasmid#161336PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC5A4 (SLC5A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC1A3_STOP
Plasmid#161055PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A3 (SLC1A3 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB3-v1
Plasmid#154893PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only