We narrowed to 15,964 results for: GRN
-
Plasmid#138189Purpose3rd generation lentiviral gRNA plasmid targeting human CDKN1ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pCAGmCherry-gRNA
Plasmid#87110PurposegRNA cloning vector with CAGmCherryDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBlu/gRNA
Plasmid#59188PurposeServes as a shuttle vector for target oligo before insertion into Cas9 destination vectorDepositorInsertGuide RNA Cassette
UseCRISPRExpressionPlantPromoterU6 (Arabidopis)Available SinceFeb. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
psgRNAv1-empty
Plasmid#171611PurposesgRNA_v1 plasmid for AsCas12f1 in bacteriaDepositorInsertAsCas12f1_sgRNA_1
ExpressionBacterialAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A
Plasmid#149369PurposeExpresses SpCas9 and sgRNA targeting the lenti-CDDR reporterDepositorInsertsCas9
sgRNA-A
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A+B
Plasmid#149370PurposeExpresses SpCas9 and two sgRNA targeting the lenti-CDDR reporter at two distal sitesDepositorInsertsCas9
sgRNA-A
sgRNA-B
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#183241Purposeanhydrotetracycline (aTC) inducible sgRNA that targets FRT scar sites and arabinose inducible lambda RedDepositorInsertsgRNA-FRT
ExpressionBacterialPromoterP-tetAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNA500
Plasmid#149640Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m
Plasmid#66193Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-gRNA
Plasmid#65626PurposeEmpty vector for the expression U6 driven gRNADepositorInsertU6-gRNA
Available SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-gRNA
Plasmid#137776PurposeContains the T7 promoter and gRNA scaffold and is used for the in vitro transcription of gRNAsDepositorInsertgRNA scaffold
UseCRISPRMutationpUC19 BsaI destroyedPromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-hEF1A-MG-U6-sgRNA
Plasmid#175505PurposeAll-in-one piggyBac transposon destination vector for hEF1a expression of Mega Gate cloned elements and hU6 expression of Golden Gate cloned guide RNAsDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhEF1a, U6Available SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only