We narrowed to 28,976 results for: Tat
-
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-mTET2HxDCD
Plasmid#228235PurposeFor targeted tethering of an inactive mutant (HxD) of the catalytic domain of mouse TET2 using dCas13DepositorInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB1-HIF2a-GFP-T2A-Puro
Plasmid#71708PurposeLentiviral expression of HIF2A-GFPDepositorAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta IC
Plasmid#202422PurposeExpression of GFP-tagged PODXL without intracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-E55A-ATPIF1
Plasmid#85404PurposeRetroviral vector expressing human ATPIF1 with E55A mutation, which abrogates the interaction between ATPIF1 and the ATP synthaseDepositorInsertATPIF1 (ATP5IF1 Human)
UseRetroviralExpressionMammalianMutationE55A point mutation abrogating the ability of ATP…Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603)R27G
Plasmid#52215Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and R27G mutationDepositorInsertHIF1alpha (401delta603) R27G (HIF1A Human)
TagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hKCNQ5(WT).ires.mScarlet-pcDNA3
Plasmid#204361PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1gamma
Plasmid#181902PurposeFluorescently tagged HP1gammaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RIT1_WT
Plasmid#82882PurposeGateway Donor vector containing RIT1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Elf5-KI-3'UTR-2A-EYFP-NLS
Plasmid#128833PurposeKnock-in of nuclear EYFP into mouse Elf5 locusDepositorInsertNuclear EYFP into Elf5 locus (Elf5 Mouse)
UseMouse TargetingAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
hBACE1(D289N).ires.mCherry-pcDNA3
Plasmid#204363PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR2-Fv-Fvls-E
Plasmid#15286DepositorInsertFGFR2 kinase, FKBP12v36 (Fgfr2 Mouse)
TagsMyristoylation-targeting domain c-Src (14aa) and …ExpressionMammalianMutationFGFR2 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLPX-rc [Chronos-GFP]
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pRRLSIN.cPPT.PGK.MD(ND2bHLH)WCS.WPRE
Plasmid#122056PurposeLentiviral expression of a MyoD chimeric protein substituted with the NeuroD2 bHLH domain and point mutations to prevent MyoD interaction with PBX/MEIS: W96A, C98A, and S253PDepositorUseLentiviralExpressionMammalianMutationMyoD chimeric protein substituted with the NeuroD…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-EF1-IRES-NEO-Control
Plasmid#80757PurposeTransposon ReporterDepositorInsertNeoR (neoR Synthetic)
PromoterEF1-IRES from PB-EF1-IRES-NEOAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1755 - pcDNA3.1 CMV-IE hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201819PurposeA plasmid expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CMV promoterDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
ExpressionMammalianPromoterpOTTC1751Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ZBTB24_WT
Plasmid#82887PurposeGateway Donor vector containing ZBTB24, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES Puro
Plasmid#110343Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Flag-FBW7K404R
Plasmid#200717PurposeThe plasmid expresses Flag-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsFlagExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-AP1S3
Plasmid#58292Purposemammalian expression of AP1S3DepositorAvailable SinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
Plasmid#156431PurposeTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTGDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II tension sensor (F40-based)
Plasmid#118715PurposeThe F40-based human desmoplakin II tension sensor detects forces in the range of 1-6 pN by changes in FRET between YPet(short) and mCherry.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.D176H
Plasmid#82870PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.G251F
Plasmid#82862PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.G56V
Plasmid#82760PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.G242W
Plasmid#82763PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.G251V
Plasmid#82765PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_STK11_p.L245F
Plasmid#82751PurposeGateway Donor vector containing STK11, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro/RAF1-P261A
Plasmid#131728PurposeMammalian Expression of RAF1DepositorAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
REV human OCT4 TALEN
Plasmid#52413PurposeTALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939)DepositorInsertHD HD HD HD HD NI NG NG HD HD NG NI NN NI NI NN NN
UseTALENPromoterCAGGSAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW-ND-Cdt1-mCherry-Puro
Plasmid#193766PurposeDoxycyline-inducible (TetOn) human Cdt1 (SV40 NLS localization and C-terminal mCherry tag) with mutations which abroggate its S phase degradation, expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertND-Cdt1-mCherry (CDT1 Human)
UseLentiviralTagsmCherryMutationamino acids 1-19 deleted, ΔCy mutation (aa68-70 t…PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL452(hygro)-Sf3b1-K700K
Plasmid#90426Purposeselectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [Chronos-tdTomato]
Plasmid#105834PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NUP88_WT_V5
Plasmid#83011PurposeGateway Donor vector containing NUP88, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only