We narrowed to 9,510 results for: control
-
Plasmid#113450PurposeLentiviral NanoLuc control expression vectorDepositorInsertNanoLuc
UseLentiviral and LuciferaseTagscmycExpressionMammalianPromoterhUbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGF1-4eCOL2A1
Plasmid#97210PurposeLentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoterDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseLentiviral and LuciferaseExpressionMammalianPromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130995PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of human synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_CDK4(R24C)-P2A-Hygro_Barcode
Plasmid#170222PurposeBarcoded lentiviral vector to express CDK4 (R24C) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123A)-EYFP
Plasmid#35507PurposeAAV expression of EF1a-driven, cre-dependent, hChR2 variant CheTA 2.0 for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationE123APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2mRFP1
Plasmid#239991PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activationDepositorInsertsmRFP1
PEST
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-CMV-H-sDarken
Plasmid#184800PurposeHigh affinity version of the Serotonin Sensor sDarken under the control of a CMV Promoter.DepositorInsertH-sDarken
ExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pomc-pGL3
Plasmid#17553PurposeLuciferase expression under control of Pomc promoter (–646 to +65).DepositorAvailable SinceOct. 17, 2008AvailabilityAcademic Institutions and Nonprofits only -
CAG FLEX BARK D110A p2A mCherry
Plasmid#117694PurposeCAG-FLEx-iBARK(D110A)-p2A-mCherry: Negative control viral expression vector for Cre-dependent Gaq silencingDepositorInsertBARKrgs D110A peptide
UseCre/LoxTagsHA / FLAGMutationD110AAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)
Plasmid#128164PurposeUV5 promoter drives expression of Zif268-consensus peptide fusion. Pair with pGHUC w-ERBIN as a positive control (turns on HIS3/GFP).DepositorInsert10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
UseSynthetic BiologyTagsFLAG and zif268ExpressionBacterialPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-ExRai-AKAR2(T/A)
Plasmid#161754PurposeNegative-control mutant for ExRai-AKAR2 biosensor.DepositorInsertExRai-AKAR2(T/A)
ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131003Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsKv2.1-HAPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 TIFA T9A
Plasmid#231590PurposeTIFA gene mutated in position T9A (mutation on phosphorylation site) under control of a doxycycline-inducible promoterDepositorInsertTIFA (TIFA Human)
UseLentiviralTags3X flagExpressionMammalianMutationT9APromoterdoxycyclineAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 TIFA WT
Plasmid#231589PurposeTIFA WT gene under control of a doxycycline-inducible promoterDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 ALPK1 WT
Plasmid#231585PurposeALPK1 WT gene under control of a doxycycline-inducible promoterDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH1-T2A-PuroR
Plasmid#162342PurposeLentiviral expression of ATOH1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130991PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of CamKIIa promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
Plasmid#217515PurposeEncodes a LexAoP controlled and Flp dependent conditional trangene of bicistronic myrGFP and KD RecombinaseDepositorInsert13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
ExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBait-YY1
Plasmid#165147PurposeBait plasmid for PROBER with YY1-binding site (positive control)DepositorInsert3X YY1 motif
UseUnspecifiedAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-HypocratesCS
Plasmid#161960PurposeMammalian expression of non-targeted inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivativesDepositorInsertHypocrates
ExpressionMammalianMutationchanged Cysteine 355 to SerinePromoterCMV, SP6Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1a_ASCL1_P2A_Hygro_Barcode
Plasmid#120427PurposeBarcoded lentiviral vector to express ASCL1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM656
Plasmid#53086PurposeA non-Phosphatidylserine binding mutant form of Lactadherin(sGFP::LactC1C2mut) to be used as a controlDepositorInsertLactaherin (Mfge8 Mouse)
TagsGFP (w/ introns) and signal sequenceExpressionWormMutationdeleted native signal sequence, deleted C-termina…Promoterhsp-16.41Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUGW-PK-hLC3∆G
Plasmid#61461PurposeExpress pHluorin-mKate2-hLC3∆G (PK-hLC3∆G), a negative control for pHluorin-mKate2-hLC3 (PK-hLC3), in mammalian cells for monitoring autophagy, based on FUGW (3rd gen lentiviral plasmid)DepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-RasAR(R89L)-NES
Plasmid#205568PurposeRasAR negative-control mutant plasmid. Targeted to cytosol.DepositorInsertRasAR(R89L)-NES (RAF1 Human, Synthetic)
TagsNuclear export signal (NES)ExpressionMammalianMutationArg 89 mutated to Leu in Raf1 RBD region.PromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_FLI1_P2A_Hygro_Barcode
Plasmid#120437PurposeBarcoded lentiviral vector to express FLI1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.Thbs1-HA.SV40(polyA)
Plasmid#195552PurposeExpresses Thbs1 under control of short GFAP promoterDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only