We narrowed to 13,645 results for: sequence
-
Plasmid#209871PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Mito-B
Plasmid#209864PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the mitochondrial membrane with C-terminal targeting sequence of human MAVSDepositorInsertddGFP B
TagsTargeting domain of MAVS RPSPGALWLQVAVTGVLVVTLLVV…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2) cloning backbone
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Mito-GA
Plasmid#209865PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the mitochondrial membrane with C-terminal targeting sequence of human MAVSDepositorInsertddGFP A
TagsTargeting domain of MAVS RPSPGALWLQVAVTGVLVVTLLVV…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pPFK300_Cas9
Plasmid#104910PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-dInPAkt
Plasmid#181834PurposeGenetically encoded single-color sensor for monitoring plasma membrane PI(3,4,5)P2 dynamics in living cells. Based on dimerization-dependent red fluorescent protein (ddRFP).DepositorInsertLyn-dInPAkt
TagsN-terminal targeting sequence from Lyn kinase, dd…ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-1x
Plasmid#172281PurposeExpressing EGFP mRNA fused with 1 tandem repeat of a 50-base sequenceDepositorInsertEGFP-N1-1x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-iCas9-neo
Plasmid#85400PurposeLentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequenceDepositorInsertFlag-iCas9-P2A-GFP
UseLentiviralTagsFlag-iCas9-P2A-GFPAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FlipCherry-T2A-GFP
Plasmid#124436PurposeExpresses FlipCherry (TEV cleavage sequence) and T2A GFP in mammalian cellsDepositorInsertFlipCherry-T2A-GFP
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSin EGFP
Plasmid#127695PurposePlasmid contains the entire replication competent Sindbis genome with the structural genome components replaced by EGFP in an MCS locus. See Resource Information section for annotated plasmid sequenceDepositorInsertEGFP
UseSynthetic BiologyAvailable SinceJuly 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-dPlcR
Plasmid#181832PurposeGenetically encoded single-color sensor for monitoring plasma membrane PI(4,5)P2 dynamics in living cells. Based on dimerization-dependent green fluorescent protein (ddGFP).DepositorInsertLyn-PlcR
TagsN-terminal targeting sequence from Lyn kinase, dd…ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Ec-7
Plasmid#163135PurposepLyGo cloning vector for surface display in E. coli of a sequence of interest (LPMO). Vector encoding the C-IgAP surface expression anchor, nanobody, and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyTagsNanobody, C-IgAP autotransporterExpressionBacterialPromoterP(rhaB)Available SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-Fis1
Plasmid#182576PurposeExpresses LifeAct-GFP targeted to the outer mitochondrial membrane via the Fis1 tail anchor sequenceDepositorInsertLifeAct-GFP-Fis1
TagsFis1 and LifeActExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pLAT1_Cas9
Plasmid#104907PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-dPlcR(K30/32L)
Plasmid#181833PurposePhospholipid binding-deficient Lyn-dPlcR negative-control plasmid.DepositorInsertLyn-dPlcR (K30L,K32L)
TagsN-terminal targeting sequence from Lyn kinase, dd…ExpressionMammalianMutationLysines 30 and 32 in PH domain mutated to leucine.PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
ER-B
Plasmid#209870PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP B
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-RA
Plasmid#209872PurposeDimerization dependent fluorescent protein RA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddRFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPObooster
Plasmid#216160PurposePlasmid expressing the RME1(ins-308A) and MKT1(30G) genes from S. cerevisiae to correct sporulation defect of S288C derived yeast lab strainsDepositorExpressionYeastMutationMKT1 gene containing an aspartic acid to glycine …Promoterendogenous promoterAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PM-B
Plasmid#209876PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the plasma membrane with the N-terminal targeting sequence of human GAP43DepositorInsertddGFP B
TagsTargeting domain of Gap43 MLCCMRRTKQVEKNDDQKIExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV BiP-Myc-KDEL-wt
Plasmid#27164PurposeMammalian expression of human Bip with Myc tag near the C-terminus, retaining the C-terminal KDEL ER localization sequenceDepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only