We narrowed to 12,952 results for: sequence
-
Plasmid#25929DepositorInsertRapR-FAK (Ptk2 Human, Mouse)
UseTagsEGFPExpressionMammalianMutationThis pEGFP-RapR-FAK-YM-KD plasmid contains the FA…PromoterAvailable SinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
J-HARS-4
Plasmid#166529PurposescFv of a human scaffold targeting Histidyl-tRNA synthetase. Antigen coverage aa 1-509 of 509, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-SARS-7
Plasmid#166527PurposescFv of a human scaffold targeting Seryl-tRNA synthetase. Antigen coverage aa 1-514 of 514, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
mito-yHS1-M7A
Plasmid#159164PurposeMitochondrial labile heme reporterDepositorInsertmito-yHS1-M7A
UseTagsCOX4 pre-sequenceExpressionYeastMutationMutated Met 7 of the cyt b562 module of mito-yHS1…PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYL214
Plasmid#171031PurposeCRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)DepositorAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-RARS-5
Plasmid#166535PurposescFv of a human scaffold targeting Arginyl-tRNA synthetase. Antigen coverage aa 70-660 of 660DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-KARS-5
Plasmid#166530PurposescFv of a human scaffold targeting Lysyl-tRNA synthetase. Antigen coverage aa 1-597 of 597, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-DARS-1
Plasmid#166538PurposescFv of a human scaffold targeting Aspartyl-tRNA synthetase. Antigen coverage aa 1-501 of 501, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-LARS-15
Plasmid#166542PurposescFv of a human scaffold targeting Leucyl-tRNA synthetase. Antigen coverage aa 260-509 of 1176DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc Fstl1
Plasmid#13497DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseTagsExpressionMutationcontains 3 tandem copies of the following sequenc…PromoterAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-V5-6xHis
Plasmid#48347PurposeContributes the coding sequence of a V5-6xHis epitope tags cassette as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertV5 and 6xHis epitope tags cassette
UseGateway entry cloneTagsExpressionMutationContains a stop codon at the end of the epitope t…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-soCoChR-mCardinal
Plasmid#107713PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. hSynapsin promoterDepositorInsertsoCoChR-mCardinal
UseAAVTagsKA2 and mCardinalExpressionMammalianMutationPromoterhSynAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
p164 Dync1i1.B
Plasmid#26435DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform B (Dync1i1 Mouse)
UseSubcloning and sequencingTagsExpressionMutationN/APromoterAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
374 pME-ets1a
Plasmid#49000Purposefull length coding sequence for zebrafish ets1a gene in gateway middle entry vectorDepositorInsertv-ets erythroblastosis virus E26 oncogene homolog 1a (ets1 Zebrafish)
UseGateway middle entryTagsExpressionMutationPromoterAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag-Smad1 (4SP/AP+AAVA)
Plasmid#14955DepositorInsertSmad1 (4SP/AP+AAVA) (SMAD1 Human)
UseTagsFlagExpressionMammalianMutationFour Serine to Alanine mutations in the linker re…PromoterAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-MCS-P2A-EGFP
Plasmid#176276PurposeViral vector for co-expression of a CDS of interest and EGFP in cells expressing Cre AND NOT Flp driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-EGFP
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
UseTagsExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…PromoterAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA GAPDH
Plasmid#162736PurposeMammalian expressionDepositorInsertSpacer sequence for GAPDH
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBXNPHM3-Nb_MsbA#1
Plasmid#186428PurposePlasmid for bacterial expression of MsbA binding Nanobody Nb_MsbA#1DepositorInsertNanobody Nb_MsbA#1
UseAffinity Reagent/ AntibodyTags3C cleavage site, His Tag, Maltose Binding Protei…ExpressionMutationPromoterpBADAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RNAseq_cal_Tuschl
Plasmid#59426PurposeEncodes sequence non-cognate to human genome for generation of RNAseq calibratorsDepositorInsertRNAseq_cal_Tuschl
UseTagsExpressionMutationPromoterAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pf113-bio
Plasmid#47729PurposeExpresses enzymatically monobiotinylated full-length Pf113 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised Pf113
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-sACt-mCherry
Plasmid#138216PurposeEncodes residues 1-469 of rat soluble adenylyl cyclase (ADCY10) fused to mCherry; plasma membrane targeted.DepositorInsertLyn-sACt-mCherry (Adcy10 Rat)
UseTagsN-terminal targeting sequence from Lyn kinase and…ExpressionMammalianMutationPromoterCMVAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
UseTagsExpressionBacterialMutationone silent mutation compared to the sequence give…PromoterAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO shMKP5.v2 puro
Plasmid#87793PurposeExpresses an inducible short hairpin targeting human MKP5 sequenceDepositorAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO shMKP5.v1 puro
Plasmid#87792PurposeExpresses an inducible short hairpin targeting human MKP5 sequenceDepositorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-FLAG/HA Ago2
Plasmid#10821DepositorInsertArgonaute 2 (AGO2 Human)
UseTagsFLAG and HAExpressionMammalianMutationR668H. Additionally, N terminus different from wi…PromoterAvailable SinceOct. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVTagsExpressionMutationPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only