We narrowed to 22,553 results for: promoter
-
Plasmid#196291Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GPDepositorInsertFull length TSWV M antigenome encoding LbCas12a in place of viral GP (cas12a Synthetic)
UseCRISPRTagsFlagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-MYC
Plasmid#130695PurposeLentiviral plasmids encoding human MYC with co-expressoin of GFP mediated by P2A.DepositorInserthuman MYC (MYC Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantMutationPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHes7-Achilles-Hes7
Plasmid#153528PurposeExpresses fusion protein of Achilles/YFP and mouse Hes7 from mouse Hes7 promoter. The reporter shows oscillatory expression with 2-3 periodicity when expressed in mouse presomitic mesoderm.DepositorInsertHes7 (Hes7 Mouse)
UseTagsAchillesExpressionMammalianMutationPromotermouse Hes7 promoterAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-SOX2
Plasmid#130693PurposeLentiviral plasmids encoding human SOX2 with co-expressoin of GFP mediated by P2A.DepositorInserthuman SOX2 (SOX2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3 basic E2
Plasmid#48747PurposeExpression of luciferase driven by mPer2 promoter fragment containing E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing E-box2 (-112 to +98)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA beta-catenin
Plasmid#18803Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expressionDepositorInsertb-catenin shRNA (CTNNB1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available sinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-EMTB-TurboID-V5
Plasmid#190736PurposeMammalian expression of EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertensconsin (MAP7 Human)
UseTagsMyc, TurboID, and V5ExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGWB540
Plasmid#74874PurposeGateway cloning compatible binary vector for C-terminal fusion with eYFP (no promoter).DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterNo PromoterAvailable sinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCamk2a-AcGFP
Plasmid#133732PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a Camk2a promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianMutationPromoterpCamk2a and pTRE3G-BiAvailable sinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC11
Plasmid#231659PurposeExpresses human ZDHHC11 proteinDepositorInsertZDHHC11 (ZDHHC11 Human)
UseTags3×Flag TagExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
413 pSG5L HA RB
Plasmid#10720DepositorInsertRB (RB1 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
p35S::AtSOBIR1-mCherry
Plasmid#86166PurposeSOBIR1-mCherry expressionDepositorInsertSOBIR1 (SOBIR1 Mustard Weed)
UseTagsmCherryExpressionPlantMutationPromoter35SAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)Luc
Plasmid#200112PurposeLuciferase reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
UseTagsExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence in minimal p…Available sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB404
Plasmid#74798PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterNo PromoterAvailable sinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only