We narrowed to 12,776 results for: NUC
-
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-2P
Plasmid#179461PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-2P
ExpressionInsectPromoterhsp70Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(DB1Δ/DB2Δ)
Plasmid#208395PurposeTo generate stable cell line expressing Halo-human MRE11(DB1Δ/DB2Δ) by Retroviral infection.DepositorInsertHuman MRE11 (MRE11 Human)
UseLuciferase and RetroviralExpressionMammalianMutationDB1delta/DB2deltaAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mIFP12-Fibrillarin-7
Plasmid#56252PurposeLocalization: Nuclear - Nucleolus, Excitation: 683, Emission: 704DepositorAvailable SinceApril 28, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHR-BRD4ΔN-miRFP670-Cry2WT
Plasmid#122439PurposeExpresses disordered protein BRD4(462-1362) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapERK)d1EGFP (KroxDs)
Plasmid#214912Purposefor PiggyBac mediated integration and stable expression of destabilised EGFP as a reporter to MAPK/ERK pathway activationDepositorInsertd1EGFP under the MapERK promoter
ExpressionMammalianPromoterMapkERK promoterAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LaminA-ECFP-SNAP
Plasmid#187965Purposeexpresses LaminA with C-terminal tags ECFP and SNAPDepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCOLADuet-1_nsp10 (SARS-CoV-2)
Plasmid#169158PurposeTo express SARS-CoV-2 nsp10 in E. coliDepositorInsertnsp10 (ORF1ab SARS-CoV-2)
TagsMethionineExpressionBacterialMutationCodon optimised for E. coliPromoterT7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW V5 Eco/Dam mse LaminA
Plasmid#182674PurposeLentiviral eukaryotic expression vector with E.Coli Dam methylation fused to mouse Lamin A. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin A.DepositorInsertLamin A (Lmna Mouse)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianPromoterHSPAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2-Sox9 T236A
Plasmid#111455PurposeTransient expression of Flag-tagged human Sox9 with T236A mutationDepositorAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-EXO1b-D173A
Plasmid#111622PurposeExpression of human catalitic dead Exonuclease 1 (EXO1) mCherry-tagged in mammalian cellsDepositorAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4F2-mCherry
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV GST mTagBFP
Plasmid#206259PurposeENTR Vector 4 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTagBFP localised to Golgi organelles under the control of CMV promoter.DepositorInsertGTS mTagBFP
UseMultimate/gateway entr 4TagsBFGT1 (Golgi localisation peptide)ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pET28_6xHis-PARP1-CAT-L713F
Plasmid#173944PurposeBacterial expression of isolated PARP1 CAT domain containing L713F gain-of-function mutationDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.dEZH2
Plasmid#220241PurposeExpression of an EZH2 catalytic site mutant in insect cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV H2B iRFP
Plasmid#206253PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes H2B iRFP713 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertH2B iRFP713
UseRecombinant baculovirus production, multimate/gat…TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TV-hPITX3-Reverse
Plasmid#22208DepositorAvailable SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-B103 (LM2963)
Plasmid#208960PurposeA variant CE1 construct with B103 DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-B103-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-PolBeta (JO574)
Plasmid#208953PurposeA variant CE1 construct with human DNA polymerase beta, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-PolBeta-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(WT)
Plasmid#177131PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(WT) with a TEV protease site located between the GST tag and PolB(WT)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-L713F
Plasmid#174794PurposeBacterial expression of a hyperactive PARP1 mutant (L713F destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-C125G
Plasmid#174792PurposeBacterial expression of a less active PARP1 mutant (C125G reduces affinity for single-strand DNA break)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2-mt2*
Plasmid#220246PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2* (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only