We narrowed to 1,864 results for: quo
-
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD128
Plasmid#163097PurposeExpression of mTurquoise2_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmTurquoise2_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-EGFP-CAAX
Plasmid#208683PurposeExpresses the membrane-localized enhanced green fluorescent protein EGFP-CAAX in mammalian cellsDepositorInsertmembrane-localized enhanced green fluorescent protein EGFP-CAAX
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-MPro-eGFP-2
Plasmid#184824PurposeExpresses Mpro-eGFP in mammalian cellsDepositorInsertMpro-eGFP conjugate (M SARS-CoV-2, jellyfish Aequorea Victoria)
UseLentiviralExpressionMammalianPromoterEF-1alfaAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV AURKA-mTurq2
Plasmid#157767PurposeExpression of AuroraA kinase fused to mTurquoise2 under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
EphA2-MT
Plasmid#108851PurposeEncodes for human EphA2 fluorescently labeled with mTurquoise on the C-Terminus via a 15 amino acid (GGS)5 flexible linkerDepositorInsertEPHA2 (EPHA2 Human)
TagsLabeled with mTurquoise on the C-Terminus via a 1…ExpressionMammalianAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarR
Plasmid#31222DepositorInsertCD4-tdTom (CD4 Fly, Human, Aequorea victoria)
TagsCD4 and tdTomatoExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP
Plasmid#216475Purposelentiviral dual expression of YAP5SA and eGFPDepositorInsertsYAP5SA
eGFP
UseLentiviralMutationS61A, S109A, S127A, S164A, S381APromoterEF1aL and UBCAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
FHL-cpmTq2-Calcium-lifetime-sensor
Plasmid#129628PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsertFHL-cpmTq2-Calcium-lifetime-sensor
Tags6x His - Modified TorA MNNNDLFQASRRRFLAQLG[G to …ExpressionBacterial and MammalianPromoterCMV,&RhamnoseAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS
Plasmid#162616PurposeAllows for transcription of control mCerulean fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmCerulean
ExpressionMammalianMutation156-239Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1_VNp-LZ-VenusN154_VNp-LZ-VenusC155 (BiFC construct)
Plasmid#182395PurposeBacterial expression of Vesicle Nucleating peptide-Leucine Zipper-amino-half_mVenus BIFC fragment n and Vesicle Nucleating peptide-Leucine Zipper-carboxyl-half_mVenus BIFC fragment fusionsDepositorInsertsVNp-LZ-VenusN154
VNp-LZ-VenusC155
TagsVesicle Nucleating peptide (VNp) & Leucine Zi…ExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-GGGS
Plasmid#162610PurposeAllows for transcription of control mVenus fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmVenus
ExpressionMammalianMutationContains aa1-155 of mVenusAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lck-cpmTq2-Calcium-lifetime-sensor
Plasmid#129627PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsertLck-cpmTq2-Calcium-lifetime-sensor
TagsLckExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarG
Plasmid#31221DepositorInsertCD4-tdGFP (CD4 Fly, Human, Aequorea victoria)
TagsCD4 and EGFP/GFPExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-3UAG
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
aP2-GFPtpz
Plasmid#114211PurposeaP2/Fabp4 promoter driving GFPtopaz for labeling differentiated adipocytes and macrophageDepositorInsertaP2 promoter + pOB4 + eGFPtopaz (Fabp4 Mouse, Synthetic, Aequorea victoria)
TagsNoneExpressionMammalianPromoteraP2/Fabp4Available SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP-CAAX
Plasmid#208684PurposeExpresses the membrane-localized enhanced green fluorescent protein EGFP-CAAX in neuronsDepositorInsertmembrane-localized enhanced green fluorescent protein EGFP-CAAX
UseAAVPromoterhSynAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xU6-PylT M15 (UUA) sfGFP 150TAA
Plasmid#154775Purposeplasmid with 4xMma PylT (M15 mutant, UUA anticodon) cassette and ochre suppression reporter sfGFP 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAA in GFP reporter, UUA anticodon and G10A, …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-RGS7
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
RIP7-RLuc-YFP-pBS
Plasmid#72482PurposeExpresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7) suitable for transfection or generation of transgenic animalsDepositorInsertsUseLuciferaseTagseYFP and renilla luciferaseExpressionMammalianMutationeYFP varientAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
3xnls-cpmTq2-Calcium-lifetime-sensor
Plasmid#129626PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-cpmTq2-Calcium-lifetime-sensor
Tags3xNLSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAG 150TAA
Plasmid#154776Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAG 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in GFP reporter, hybrid PylT with A…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 150TAG
Plasmid#154772Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, hybrid PylT with A41AA an…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAA 150TAG
Plasmid#154777Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAA 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAA 150TAG in GFP reporter, hybrid PylT with …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSGFPnERT(#205)
Plasmid#184065Purposecyclofen-inducible GFP nuclear relocation via mammalian cell transfection or mRNA synthesisDepositorInserteGFP-nls-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSS02:cyt-Peredox-mCherry
Plasmid#161743Purposecytosolic expression of fluorescent NADH/NAD+ biosensor Peredox-mCherry in plantsDepositorInsertcyt-Peredox-mCherry
ExpressionPlantPromoterUbiquitin 10Available SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRD439
Plasmid#168465PurposeFor the insertion pf NLS-mTurquoise2-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mTurquoise2-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-GFP Q185N N186C pLVX CMVpuro
Plasmid#246913PurposeLentiviral-based expression of EGFP with an ER retention signal sequence and Q185N N186C, an STT3B-specific glcosylation sequonDepositorInsertEGFP
UseLentiviralTagsER signal sequence and KDEL ER retention sequenceExpressionMammalianMutationQ185N N186C STT3B-specific sequon to allow for fl…PromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2705-AGER-eGFP
Plasmid#216474Purposedonor vector for targeting an eGFP reporter to the human AGER locus at the endogenous ATG start siteDepositorInserteGFP
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-Lyn-GFP-bGH]
Plasmid#196884PurposeDual Cre/Dre-dependent expression of LynGFP. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-Lyn-GFP-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-Flex/3'USS-ChRWR/Venus(ATG mut)
Plasmid#197891PurposeCan be used to generate AAV virus that will express ChRWR/Venus in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertChRWR/Venus
UseAAVMutationN/APromoterEF1aAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only