We narrowed to 48,723 results for: TOR
-
Plasmid#118067PurposeTranscriptional unit for constitutive expression of GrRenilla in mammalian cellsDepositorInsertCMV:GreenRenilla:bGHF
UseLuciferase and Synthetic Biology; Assembly of gb2…ExpressionMammalianPromoterCMVAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
JN302: pMVP/SB/Puro-DEST
Plasmid#121865PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Puro selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-E55A-ATPIF1
Plasmid#85404PurposeRetroviral vector expressing human ATPIF1 with E55A mutation, which abrogates the interaction between ATPIF1 and the ATP synthaseDepositorInsertATPIF1 (ATP5IF1 Human)
UseRetroviralExpressionMammalianMutationE55A point mutation abrogating the ability of ATP…Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-TPX2(1-43)
Plasmid#69107PurposeFor bacterial expression of human TPX2(1-43aa) tagged with GST.DepositorInsertTargeting Protein for Xklp2 (TPX2 Human)
TagsGSTExpressionBacterialMutationAmino acids 1-43 expressed.Available SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
1000.pCCLsin.cPPT.hPGK.Brn2.MIRT124_x4 Xma_lost.WPRE
Plasmid#67295PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-FOXL2
Plasmid#192914PurposeBarcoded piggybac transposon vector with Dox-inducible expression of FOXL2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
ND4.2-Left TALE-G1397-N-DddA11
Plasmid#179681PurposeExpression of base editor in mammalian cellsDepositorInsertCOX8a MTS_3xFLAG_ND4.2 Left TALE_2aa_DddA G1397-N (S1330I A1341V N1342S E1370K T1380I)_1xUGI_ATP5B 3'UTR
ExpressionMammalianMutationS1330I A1341V N1342S E1370K T1380IAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP
Plasmid#137164PurposeIntersectional viral expression of EYFP in cells expressing Cre AND Flp AND VcreDepositorHas ServiceAAV Retrograde and AAV8Insert3x-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
YE2-BE4max
Plasmid#138156PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE2)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R132E; within Cas9 D10APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
LC101: pMVP/PB/Neo-DEST
Plasmid#121875PurposepMVP destination vector, empty PiggyBac transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUsePiggybac transposon, pmvp gateway destination vec…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HLA-A0201-His
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR-II-TOPO-mitfa_LexPR-2A-Cerulean-SV40pA-FRT-Kan-FRT: Sequences,
Plasmid#110201PurposeMelanocyte-specific expression of the LexPR-2A-Cerulean fusionDepositorInsertLexPR transactivator - 2A - Cerulean
TagsCeruleanExpressionBacterialAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 HA-hTSPAN12
Plasmid#115784PurposeExpresses human TSPAN12 with N-terminal HA-tag in mammalian cells. Contains multiple silent mutations that introduce restriction sites.DepositorInsertTSPAN12 (TSPAN12 Human)
TagsHAExpressionMammalianMutationmultiple silent mutations introduce restriction s…PromoterCMVAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIZ-EGFP-MYO10-HMM
Plasmid#87257PurposeExpression plasmid to perform NanoSPD assays in insect cells (generates EGFP-tagged bait).DepositorInsertMYO10 (Myo10 Mouse)
ExpressionInsectMutationMyo10 is truncated to contain aa.1-941PromoterOpIE2Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGateway CloningTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TA)
Plasmid#61513PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TA mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TA mutation (see comments), Tom20, and m…ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC414 - pAAV EF1a hPREP
Plasmid#59967PurposeAn AAV packaging vector that expresses hPREP under control of the EF1a promoter.DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.T7 delta-NFAT3
Plasmid#28224DepositorInsertDelta NFAT3 (NFATC4 Human)
TagsT7ExpressionMammalianMutationhNFAT3 WT deleted amino acids 1-342PromoterCMVAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCS_FLPER(T2)
Plasmid#31303DepositorInsertFLP-ER ligand binding domain (ESR1 Human, Budding Yeast)
ExpressionMammalianMutationfull length FLP linked to ligand binding domain o…Available SinceOct. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
Gal4 PGC1 alpha L2/3A
Plasmid#8898DepositorInsertPGC-1a (Ppargc1a Mouse)
TagsGal4 DBDExpressionMammalianMutationLXXLL at aa140 is changed to AXXLL; LLXXL at aa 2…Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC
Plasmid#221363PurposeMammalian expression of Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC; to be used with Anti-His [IPI-HAP1/5.13.22] light chain (Plasmid 221364) to make the antibody.DepositorInsertAnti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-CMV-XRCC1-EGFP-Hygro
Plasmid#176062PurposeEGFP fused to the C-terminus of XRCC1 & a hygromycin resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsEGFPExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRetro-XT-PAK2-CFP(puro)-T402A
Plasmid#81179PurposeRetroviral vector for expression of kinase inactive PAK2 with a CFP fusionDepositorInsertp21 (RAC1) activated kinase 2 (PAK2 Human)
UseRetroviralTagsCFPMutationT402APromoterP-tight TREAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
TMED9-bio-His
Plasmid#51855PurposeExpresses full-length Transmembrane emp24 domain-containing protein 9 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertTMED9 (TMED9 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBV-Luc/Frag-F
Plasmid#14053DepositorInsertc-myc promoter (-109/-3) (MYC Human)
UseLuciferaseExpressionMammalianMutation-109/-3 (relative to the P2 transcription initiat…Available SinceMay 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-HA-MmUbc6/2774
Plasmid#11482DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only