We narrowed to 35,146 results for: LAT
-
Plasmid#50820PurposeExpresses enzymatically monobiotinylated full length SERA9DepositorInsertSERA9
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1P552L-CMyc
Plasmid#50736PurposeProduces lentivirus expressing human EWSR1P552L mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 P552L (EWSR1 Human)
UseLentiviralTagsFLAG and MycMutationChanged Pro 552 to LeuPromoterTREAvailable SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV mClover3-Galectin-3
Plasmid#215376PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-con/fon DREADD Gq-mCherry
Plasmid#200661PurposeConstruct for chemogenetically activating and visualizing subpopulations of neurons in the retinaDepositorInsertDREADD Gq-mCherry
UseAAV, Cre/Lox, and Mouse Targeting ; IntrsectTagsmCherryExpressionMammalianPromoterhSynAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
dTAG-IRF8
Plasmid#190620PurposeLentiviral expression plasmid of human IRF8 fused with FKBP12G36V for dTAG-mediated degradationDepositorInsertIRF8 (IRF8 Human)
UseLentiviralTagsFKBP12_G36VExpressionMammalianMutationsynonymous mutation for sgRNA resistance for sgIR…Available SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-BDNF-pHluorin
Plasmid#187193PurposeTo express the mouse BDNF tagged with the FP pHluorinDepositorInsertBDNF (Bdnf Mouse)
UseLentiviralTagspPHluorinExpressionMammalianMutationThe codon were optimized for better expressionPromoterCMVAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-PD-1 (Y223F, Y248F)-mGFP
Plasmid#180790PurposeExpression of human PD-1 (Y223F, Y248F) fused to mEGFPDepositorInsertPD-1 (Y223F, Y248F) (PDCD1 Human)
UseLentiviralTagsmEGFPMutationPD-1 (Y223F, Y248F)PromoterSFFVAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -2
Plasmid#180009PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-NES
Plasmid#171006PurposeHiLITR protease with C-terminal NNES (Cytoplasmic)DepositorInsertEGFP-uTEV1-NES
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIG2-Flag-mNuak1 WT
Plasmid#168507PurposeFor expression of Nuak1 (AMPK-related kinase also called ARK5/Omphk1)DepositorAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.RBBP4
Plasmid#125164PurposeExpresses human RBBP4 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorInsertHistone-binding protein RBBP4 (RBBP4 Human)
TagsHis-MBPExpressionInsectPromoterPolyhedrinAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.EZH2
Plasmid#125161PurposeExpresses human EZH2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Puro-TDP-43-K263E
Plasmid#133758PurposeLentiviral expression of human TDP-43 K263E disease mutant in mammalian cells.DepositorInsertTDP-43 (TARDBP Human)
UseLentiviralExpressionMammalianMutationChanged lysine 263 to glutamate.PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-Epac1 SAAX
Plasmid#118313PurposeExpression of human Epac1DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A
Plasmid#66819PurposedCas9 fused to BFP and the human DNMT3A catalytic domainDepositorInsertdSpCas9-BFP-DNMT3A, catalytic domain of DNMT3A
TagsdSpCas9-BFP-DNMT3AExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEB1-moxGFP
Plasmid#103984PurposePlasmid encoding moxGFPDepositorInsertmoxGFP
UseLow copyExpressionBacterialMutationMutations relative to wild-type GFP (S30R, Y39N, …PromoterproCAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only