We narrowed to 2,997 results for: COB;
-
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V1
Plasmid#222503PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V3
Plasmid#222506PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222508PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNES-SET-EMD-EGFP (C-NES-SET-EMD)
Plasmid#217770PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
TagsEGFPExpressionMammalianMutationEMD domain (aa 70-226) plus nuclear export sequen…PromoterCMVAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2X-KSR1-CA3-EGFP (2x-C-KSR)
Plasmid#217756PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationTwo tandem CA3 domain (aa 317-400) 1st linker GG…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_ZKSCAN5_SMO
Plasmid#205960PurposeExpress mEGFP-tagged fusion protein, ZKSCAN5_SMO from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_TRIOBP_RBFOX2
Plasmid#205947PurposeExpress mEGFP-tagged fusion protein, TRIOBP_RBFOX2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SEMA6C_DLG2
Plasmid#205919PurposeExpress mEGFP-tagged fusion protein, SEMA6C_DLG2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SETD2_CCDC12
Plasmid#205920PurposeExpress mEGFP-tagged fusion protein, SETD2_CCDC12 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SNTB2_ZCRB1
Plasmid#205924PurposeExpress mEGFP-tagged fusion protein, SNTB2_ZCRB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SPTLC3_PSMF1
Plasmid#205926PurposeExpress mEGFP-tagged fusion protein, SPTLC3_PSMF1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SSR1_FARS2
Plasmid#205930PurposeExpress mEGFP-tagged fusion protein, SSR1_FARS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PRKCE_AFTPH
Plasmid#205901PurposeExpress mEGFP-tagged fusion protein, PRKCE_AFTPH from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PTK2_PSMA7
Plasmid#205904PurposeExpress mEGFP-tagged fusion protein, PTK2_PSMA7 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RABGAP1L_BCAS3
Plasmid#205906PurposeExpress mEGFP-tagged fusion protein, RABGAP1L_BCAS3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MED13L_COL23A1
Plasmid#205849PurposeExpress mEGFP-tagged fusion protein, MED13L_COL23A1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MSH6_FBXO11
Plasmid#205859PurposeExpress mEGFP-tagged fusion protein, MSH6_FBXO11 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MYDGF_DNM2
Plasmid#205863PurposeExpress mEGFP-tagged fusion protein, MYDGF_DNM2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FUT10_GAB2
Plasmid#205823PurposeExpress mEGFP-tagged fusion protein, FUT10_GAB2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_GFM1_MLF1
Plasmid#205825PurposeExpress mEGFP-tagged fusion protein, GFM1_MLF1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ITGB6_RBMS1
Plasmid#205831PurposeExpress mEGFP-tagged fusion protein, ITGB6_RBMS1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ITSN2_ADCY3
Plasmid#205832PurposeExpress mEGFP-tagged fusion protein, ITSN2_ADCY3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_JARID2_SYNCRIP
Plasmid#205834PurposeExpress mEGFP-tagged fusion protein, JARID2_SYNCRIP from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KAT6A_ADAM2
Plasmid#205835PurposeExpress mEGFP-tagged fusion protein, KAT6A_ADAM2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ADIPOR2_FOXJ2
Plasmid#205768PurposeExpress mEGFP-tagged fusion protein, ADIPOR2_FOXJ2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_QKI
Plasmid#205771PurposeExpress mEGFP-tagged fusion protein, ARID1B_QKI from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ATP5B_VWA3B
Plasmid#205778PurposeExpress mEGFP-tagged fusion protein, ATP5B_VWA3B from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_26
Plasmid#60306PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_34
Plasmid#60313PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_12
Plasmid#60319PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS C18orf26)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_14
Plasmid#60321PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS CCRN4L)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_7
Plasmid#60256PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSLC30A8 enhancer (SLC30A8 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_15
Plasmid#60262PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertFAM148A enhancer (C2CD4A Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_17
Plasmid#60263PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZFAND3 enhancer (ZFAND3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_18
Plasmid#60264PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZBED3 enhancer (ZBED3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_19
Plasmid#60265PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertTHADA enhancer (THADA Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only