We narrowed to 12,778 results for: NUC
-
Plasmid#174809PurposeBacterial expression of isolated PARP1 HD subdomainDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.HA.V5_mCherry-NLS
Plasmid#178283PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
OCT4 GFP puro Donor 2
Plasmid#22210DepositorInsertSA-OCT-GFP-2APuro-PA (POU5F1 Human)
Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.VSVg.V5_mCherry-NLS
Plasmid#178236PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.S.VSVg_mCherry-NLS
Plasmid#178234PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 HA(Δ2-126) (HindIII- BamHI- EcoRI)
Plasmid#70668PurposeHuman mutant of E2F1 lacking amino acids 2 to 126DepositorInsertE2F1 lacking residues 2 to 126 (E2F1 Human)
TagsHAExpressionMammalianMutationlacks amino acids 2-126PromotercmvAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2(AA,3Q)
Plasmid#192444PurposeEncodes mCherry-tagged TSC2 isoform 5 with S939A, T1439A, K1614Q, K1615Q, R1616Q mutations to disrupt Akt phosphorylation and GAP activity.DepositorInsertmCherry-TSC2(S939A,T1439A,K1614Q,K1615Q,R1616Q ) (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationTSC2 Ser 939 and Thr 1439 (equivalent to 1462 in …PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
VP16-ER beta (short)
Plasmid#11353DepositorInsertER beta short (ESR2 Human)
ExpressionMammalianAvailable SinceMarch 10, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-dSpCas9-HF1-VP64-6xHis
Plasmid#92118PurposeExpression of dead/inactive increased fidelity SpCas9-HF1-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive SpCas9-HF1-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-HTR6-SNAPf-TRIP
Plasmid#189617PurposeExpresses cilia-targeted RhoA inhibitory peptide, tet-inducibleDepositorInsertHTR6-TRIP_alpha
UseAAVTagsalphaTag in the N-term of HTR6, SNAP-tag in the C…PromoterTREAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM-cytoBirA-2A-mCherry-SV40pA-FKF
Plasmid#79887PurposeDonor cassette containing HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
ExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_DIO_R106W-HaloTag
Plasmid#164063PurposeDouble-Floxed Inverted Open reading frame for mouseMeCP2(alpha) carrying R106W mutationDepositorAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only