We narrowed to 34,400 results for: CaS;
-
Plasmid#104629Purposebacterial expression of light-activated caspase-3 with N7C-7 linker variationDepositorInsertCaspase-3 (CASP3 Human)
UseTagsHis and LOV2ExpressionBacterialMutationPromoterT7Available sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
ttAtCas12a+int
Plasmid#182384PurposeGives very high editing efficiency in barley. Also works in Brassica oleraceaDepositorInsertLbCas12a coding sequence with D156R and Arabidopsis introns
UseCRISPRTagsExpressionMutationD156R + 8 Arabidopsis introns addedPromoterNoneAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9 Null
Plasmid#198727PurposeExpresses Cas9 without a mobility signal and the mRNA is not graft mobile. Induced by estradiol.DepositorInsertCas9
UseTagsExpressionPlantMutationPromoterpG10-90Available sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
UseTagsExpressionBacterialMutationD10A & H840APromoterAvailable sinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET_StrepII_TEV_LIC_TniQ(PmcCAST)
Plasmid#224927PurposeTniQ expression plasmid for the co-purification of TnsC-TniQ complexDepositorInsertTniQ
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianMutationPromoterLac promoter, SV40, and T7 promoterAvailable sinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
SadCas9 VPR
Plasmid#188514PurposeExpresses FLAG tagged SadCas9 VPRDepositorInsertdCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A/N580APromoterEF1aAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-Hf-RfxCas13d-HA
Plasmid#234479PurposePlasmid to carry out IVT of High-fidelity RfxCas13d (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTagsHAExpressionMutationChanged four alanine to valine in positions 134, …PromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas12b(RuvC)
Plasmid#186450PurposeEncodes catalytically inactive Cas12b (E848A, D977A) from A. acidoterrestris (type V-B)DepositorInsertdCas12b
UseCRISPRTagsExpressionMutationE848A, D977APromoterT7Available sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRTagsExpressionMutationPromoter2x35SAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJL1-SpCas9
Plasmid#117051PurposeIn vitro expression of S. pyogenes Cas9 from the T7 promoterDepositorInsertS. pyogenes Cas9
UseTagsExpressionBacterialMutationPromoterT7Available sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
His_CL7_2NLS_iCas12a-4NLS
Plasmid#222971PurposeBacterial expression of NLS-rich iCas12a constructDepositorInsertHis_CL7_2NLS_iCas12a-4NLS
UseCRISPRTagsCL7 and HisExpressionBacterialMutationPromotertacAvailable sinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-MSK1
Plasmid#165601PurposeExpresses Sp dCas9 fused to human MSK1DepositorInsertribosomal protein S6 kinase A5 (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorInsertPrkaa1 (Prkaa1 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
SauKKHCas9 PE2*
Plasmid#169852PurposeMammalian Expression, sauCas9-KKH based prime editorDepositorInsertSaCas9KKH-N580A-M-MLV
UseTagsbpSV40 NLS and SV40 NLS and cmyc-NLS and bpSV40 N…ExpressionMammalianMutationPromotercmvAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p276 eSpCas9_2gRNAs_hH11
Plasmid#164850PurposegRNA vector for targeting human H11 locusDepositorInsertgRNAs for targeting human H11 locus
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only