We narrowed to 22,939 results for: REP
-
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYL-kasOp-FnCas12a3
Plasmid#177875PurposeExpresses Streptomyces codon optimized FnCas12a. Used to modify genome of Streptomyces.DepositorInsertStreptomyces codon optimized the FnCas12a mutant EP16
UseCRISPRPromoterkasOp*Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
SPLICS Mt-ER- Po Short P2A
Plasmid#164118PurposeDetect the short Peroxisomes-mitochondria-Endoplasmic reticulum contactDepositorInsertSplit GFP and YFP Mt-ER- Po Short P2A
ExpressionMammalianAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-LIN-41
Plasmid#52716Purposeretroviral expression of human LIN-41 / TRIM71DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
GADD45 P-2/3m-luc
Plasmid#8359DepositorInsertGADD45 promoter P-2/3m (GADD45A Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationP-2/3mAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
TagsCas9-Venus fusion proteinExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ii-Str_ST-SBP-mCherry
Plasmid#65269Purposesynchronize trafficking of ST from the ER (RUSH system)DepositorInsertIi-Streptavidin and truncated sialyltransferase (ST6GAL1 Human)
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCCL-GKL1RC-Short-LEUg1mKateg2GKL2ORF10UCS
Plasmid#52345PurposeIntegration cassette to create p1-Short-Leu-mKate with p2 ORF10 UCS>mKateDepositorInsertmKate2
UseP1 integration vectorExpressionBacterialMutationchanged V2HPromoterpGKL2 ORF10 UCSAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_ENTR_TOP-iRFP_L5-L4
Plasmid#113866PurposeSingle pathway reporter; wnt promoter-driven expression of iRFP; MultiSite Gateway entry vector.DepositorInsertsTOP (wnt dependent promoter)
iRFP713
UseGateway CloningExpressionMammalianAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FAM208A
Plasmid#115845PurposeEncodes codon optimized HA tagged FAM208ADepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC_P2A_Hygro_Barcode
Plasmid#120461PurposeBarcoded lentiviral vector to express MYC in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK-GAFm
Plasmid#39868DepositorInsertiRFP protein GAF domain (mutated)
TagsK coilExpressionMammalianMutationF165Y, D232Y, W308RPromoterCMVAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAEL005635-Cas9
Plasmid#100608PurposeThe promoter of AAEL005635 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL005635-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL005635 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-cAMPr
Plasmid#160723PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter cAMPr (cAMP indicator), HA tag, and S2 protein scaffold.DepositorInsertS2-cAMPr
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSP1E2D1
Plasmid#161606PurposeBacterial expression of "extended" membrane scaffold protein MSP1E2D1 for Nanodisc formationDepositorInsertMSP1E2D1
Tags7-HisExpressionBacterialMutation"extended" MSP1D1; contains repeat of h…PromoterT7Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SNAI2_P2A_Hygro_Barcode
Plasmid#120478PurposeBarcoded lentiviral vector to express SNAI2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cyclin D1 shRNA-B
Plasmid#32494DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only