We narrowed to 7,325 results for: 11
-
Plasmid#216410PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y450/Y452/Y456 to serine mutationsDepositorInsertEfg1-ΔDBD-Y450S/Y452S/Y456S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 450, 452 and 456 to Serine, and …Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y478S/Y482S/Y484S
Plasmid#216411PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y478/Y482/Y484 to serine mutationsDepositorInsertEfg1-ΔDBD-Y478S/Y482S/Y484S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 478, 482 and 484 to Serine, and …Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh10.1 GFP
Plasmid#209102PurposeGFP expressing scramble of shRNA targeting Cdh10DepositorInsertscrCdh10.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh11.1 GFP
Plasmid#209103PurposeGFP expressing shRNA targeting Cdh11DepositorInsertshCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh2.1 GFP
Plasmid#209099PurposeGFP expressing shRNA targeting Cdh2DepositorInsertshCdh2.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh11.1 GFP
Plasmid#209104PurposeGFP expressing scramble of shRNA targeting Cdh11DepositorInsertscrCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.2-GFP
Plasmid#209098PurposeGFP expressing scramble of shRNA targeting Ctnnd2 3' UTRDepositorInsertscrCtnnd2.2
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_Caspase-11_humanized-mutant
Plasmid#214315PurposeProtein overexpression in bacteriaDepositorInsertCASP4 (Casp4 Mouse)
TagsHis-TEVExpressionBacterialMutationN152K_KLS288YKT_KASIHS348TPRAKAPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF823_EFS-Cas9-P2A-Puro
Plasmid#211645PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF226_EFS-Cas9-P2A-Puro
Plasmid#211644PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-scrCtnnd2.1-mCherry-CAAX
Plasmid#209108PurposeMembrane tethered mCherry scramble of shRNA targeting Ctnnd2 N-terminusDepositorInsertscrCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-shCtnnd2.1-mCherry-CAAX
Plasmid#209107PurposeMembrane tethered mCherry shRNA targeting Ctnnd2 N-terminusDepositorInsertshCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh20.1 GFP
Plasmid#209105PurposeGFP expressing shRNA targeting Cdh20DepositorInsertshCdh20.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.2-GFP
Plasmid#209097PurposeGFP expressing shRNA targeting Ctnnd2 3' UTRDepositorInsertshCtnnd2.2
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.1-GFP
Plasmid#209096PurposeGFP expressing scramble of shRNA targeting Ctnnd2 N terminusDepositorInsertscrCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRV∆L-5tTA
Plasmid#182966PurposeThe 3rd generation of rabies vector expressing a tetracycline-controlled transactivator (tTA)DepositorInserttTA
UseRabiesAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT348
Plasmid#204515PurposeBacterial expression of CEC-5 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of cec-5 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-hEFA6C
Plasmid#206414PurposeMammalian expression of hEFA6CDepositorAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
Tags2xHAExpressionWormPromoterrpl-21 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
Tags2xFLAGExpressionWormPromotercsr-1 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT334
Plasmid#204516PurposeBacterial expression of COH-3 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of coh-3 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT186
Plasmid#204513PurposeBacterial expression of CSR-1 PAZ domain with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertPAZ domain of csr-1 (C. elegans) (csr-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT521
Plasmid#204520PurposeBacterial expression of CEC-5 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-5 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT520
Plasmid#204519PurposeBacterial expression of CEC-8 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-8 (C. elegans) (Y55B1BR.3 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT342
Plasmid#204514PurposeBacterial expression of SYP-1 N-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertN-terminal fragment of syp-1 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT320
Plasmid#204517PurposeBacterial expression of HIM-1 internal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertInternal fragment of him-1 (C. elegans) (him-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
NeuA.pJL1
Plasmid#199115PurposeIn vitro expression of N-acylneuraminate cytodiylyltransfease (NeuA), which conjugates sialic acid and CTP to make activated sugar donor, CMP-sialic acid (see CSTI.PJL1 and PdST6.PJL1)DepositorInsertN-acylneuraminate cytodiylyltransfease (NeuA)
TagsStrep-tagExpressionBacterialPromoterT7Available SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Derp2.pJL1
Plasmid#199116PurposeIn vitro expression of Der p 2, a major common allergen from Dermatophagoides pteronyssinus (dust mite), with synthetic site for glycosylation encoded (GGNWTT)DepositorInsertDer p 2 dust mite allergen
TagsGlyctag, His-tagExpressionBacterialPromoterT7Available SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-60-NusA-DmEDC3_1-101_D
Plasmid#146126PurposeBacterial Expression of DmEDC3_1-101DepositorInsertDmEDC3_1-101 (Edc3 Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1_1963-2505-dsRNAres_AC
Plasmid#148403PurposeInsect Expression of Dmot1_1963-2502-dsRNAresDepositorInsertDmot1_1963-2502-dsRNAres
ExpressionInsectMutation2 silent mutations compared to the sequence given…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot7-D40AE42A_AF
Plasmid#148675PurposeBacterial Expression of HsNot7-D40AE42ADepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-HsNot7-NpM-HsNot6_AF
Plasmid#148645PurposeBacterial Expression of HsNot7-HsNot6DepositorInsertHsNot7-HsNot6 (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Rtn2b-R60f-mCherry
Plasmid#186607PurposeThird generation lentiviral vector expressing Reticulon 2 disease mutant R60f fused to mCherryDepositorInsertHuman Reticulon 2 mutant R60f (RTN2 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationc.178insC (R60f)PromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Rtn2b-mNeon-TurboID
Plasmid#186612PurposeThird generation lentiviral vector expressing full-length Reticulon 2 fused to mNeonGreen and V5-TurboIDDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-271-mNeon
Plasmid#186601PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 271 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 271 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-135-mNeon
Plasmid#186602PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 135 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 135 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD1-60-mNeon
Plasmid#186603PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 1 to 60 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 1 to 60 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-NTD136-271-mNeon
Plasmid#186604PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 136 to 271 fused to mNeonGreenDepositorInsertHuman Reticulon 2 isoform B amino acids 136 to 271 (RTN2 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VC155
Plasmid#194051PurposeTransient expression of VN155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Cytosol)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-mCCK2R-stop
Plasmid#179321PurposeExpress mouse cholecystokinin 2 receptor (untagged) in mammalian cellsDepositorInsertmouse cholecystokinin2 receptor
ExpressionMammalianMutationstop codon after ORFPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Mouse-caspase-1/11b
Plasmid#183392PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of mouse caspase-1 fused to mouse caspase-11 (Casp1 Mouse, Synthetic)
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
gMUM2-Citrine
Plasmid#181965PurposeMUM2 protein fused to Citrine, under control of native promoterDepositorAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
MUM2SP-Citrine
Plasmid#181963PurposeMUM2 signal peptide fused to Citrine, under control of MUM4_1.5kb promoterDepositorInsertMUM2 signal peptide, fused to the Citrine YFP in pAD
TagsCitrine YFPExpressionPlantPromoterMUM4pro 1.5kb fragmentAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmLSm1_A
Plasmid#145886PurposeInsect Expression of Dm-Lsm1DepositorInsertDm-Lsm1
ExpressionInsectMutationTwo silent mutation compared to the sequence give…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmLSm4_A
Plasmid#145889PurposeInsect Expression of Dm-Lsm4DepositorInsertDm-Lsm4
ExpressionInsectMutationone non silent mutation G127R compared to the seq…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmLSm7_A
Plasmid#145891PurposeInsect Expression of DmLSm7DepositorInsertDmLSm7 (LSm7 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only