We narrowed to 1,647 results for: Tyr
-
Plasmid#139968PurposeDonor vector to knockin EGFP (separated by 2A) into EPHB4 alleleDepositorInsertHuman EPHB4 knockin homology arms (EPHB4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorInsertOptoFGFR1-Y766F (FGFR1 Human, Mustard Weed)
UseTagsmCitrineExpressionMammalianMutationPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116A
Plasmid#123245PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116A. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationGlycine 116 to AlaninePromoterPGKAvailable sinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001145313)
Plasmid#76354Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001144879)
Plasmid#76352Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001148436)
Plasmid#76353Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…ExpressionMutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available sinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
EPHB3_HUMAN_D0
Plasmid#79732PurposeThis plasmid encodes the kinase domain of EPHB3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHB3 (EPHB3 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3_HUMAN_D0
Plasmid#79708PurposeThis plasmid encodes the kinase domain of EPHA3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHA3 (EPHA3 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2_HUMAN_D0
Plasmid#79697PurposeThis plasmid encodes the kinase domain of EPHB2. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHB2 (EPHB2 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAMP1-Y414A
Plasmid#222319PurposeSynchronize the trafficking of LAMP1-Y414A from the ER.DepositorInsertStreptavidin-KDEL and LAMP1-Y414A fused to SBP-EGFP (LAMP1 Human)
UseTagsExpressionMammalianMutationTyr414 to AlaPromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
UseTagsExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…PromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
UseTagsExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835N-V5/HIS
Plasmid#236008Purposeexpression of the D835N kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid LeukemiaDepositorInserthuman FLT3-D835N receptor tyrosine kinase, full length (FLT3 Human)
UseTagsV5/HisExpressionMammalianMutationD835N substitutionPromoterCMVAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMal_Abl-PRM 3R
Plasmid#112086PurposeBacterial expression plasmid containing His and MBP tags for 3 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-3R (ABL1 Human)
UseTagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAL-Abl-PRM 4R
Plasmid#112087PurposeBacterial expression plasmid containing His and MBP tags for 4 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-4R (ABL1 Human)
UseTagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMal-Abl-PRM 5R
Plasmid#112088PurposeBacterial expression plasmid containing His and MBP tags for 5 PRM motif repeats of Human Abl.DepositorInsertPRM-5R (ABL1 Human)
UseTagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD∆cat
Plasmid#81054Purposebacterial expression of catalytic dead catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
UseTags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057 with histid…PromoterT7Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147883)
Plasmid#76743Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorInsertEPHA3 (EPHA3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147140)
Plasmid#76745Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorInsertEPHA3 (EPHA3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB2-SV40-GFP (B2G)
Plasmid#65442PurposeExpression of mouse EPHB2 and GFP in mammalian cellsDepositorInsertEPHB2 (Ephb2 Mouse)
UseLentiviralTagsSV40-EGFPExpressionMammalianMutationSee depositor comments below.PromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146797)
Plasmid#76700Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorInsertAXL (AXL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001147657)
Plasmid#76701Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorInsertAXL (AXL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146919)
Plasmid#76702Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorInsertAXL (AXL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB3-v1
Plasmid#154893PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorInsertERBB3 (ERBB3 Human)
UseTagsVenus fragment 1 (v1)ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-Y195F
Plasmid#203573PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Tyrosine 195 to Phenylalanine for partial…PromoterCMVAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MERTK gRNA (BRDN0001145505)
Plasmid#76444Purpose3rd generation lentiviral gRNA plasmid targeting human MERTKDepositorInsertMERTK (MERTK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only