We narrowed to 167,150 results for: Gene
-
Plasmid#238498PurposeIVT mRNA of human geneDepositorInsertARHGAP11B (ARHGAP11B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GPR89B_full_pGCS1
Plasmid#238499PurposeIVT mRNA of human geneDepositorInsertGPR89B (GPR89B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCLJ-Fgf5-t2A-eGFP
Plasmid#227504PurposeInserts t2a-eGFP at the 3' end of the Fgf5 gene alsong with a removable selection cassetteDepositorInsertEGFP
UseAAV and Cre/LoxAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pGEMT-mMyh7CDS
Plasmid#192849PurposePlasmid to produce ISH probe for mMyh7 gene with CDS sequenceDepositorInsertmyosin heavy chain 7 (Myh7 Mouse)
Available SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-mMyh7UTR
Plasmid#192850PurposePlasmid to produce ISH probe for mMyh7 gene with UTR sequenceDepositorInsertmyosin heavy chain 7 (Myh7 Mouse)
Available SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
JD226
Plasmid#229484PurposeAdenoviral helper plasmid containing E2A, VA RNA I and L4-22k genesDepositorInsertE2A, VA RNA I, L4-22k
UseAAV and AdenoviralExpressionMammalianPromoterCMV (E2A), Ef1a (L4-22k) and wt promoter (VA RNA …Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-Gja1prom
Plasmid#188114PurposeExpresses luciferase under control of Gja1 promoter in transfected cellsDepositorInsertGja1 promoter (Gja1 Mouse)
UseLuciferasePromoterGja1 endogenous promoter up to gene start codonAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-LS
Plasmid#205438PurposeExpression of Gaussia luciferase (gLuc) and spectinomycin resistance (Spec) genesDepositorInsertsGaussia luciferase gene
spectinomycin resistance gene
UseCre/Lox and Luciferase; Chlamydomonas expressionPromoterHeat shock protein 70A (HSP70A)/ribulose bisphosp…Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P1
Plasmid#124455PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P1_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P2
Plasmid#124456PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P2_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P3
Plasmid#124457PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P4
Plasmid#124458PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P4_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P5
Plasmid#124459PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P5_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-1
Plasmid#124474PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-1_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-2
Plasmid#124475PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-2_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-3
Plasmid#124476PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-4
Plasmid#124477PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-4_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E3-3
Plasmid#124484PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E3-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLD-CAG-DYSF-CPL
Plasmid#131458PurposeEncodes Dysferlin protein (Therapeutic gene) protein to cure LGMD2B along with luciferase enzyme for in vivo live imagingDepositorInsertDYSF (DYSF Human)
ExpressionBacterial and MammalianAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PW124-LMNA 5'HA-TriTag (mCherry)-3'HA (HDR donor)
Plasmid#164047PurposeCRISPR donor plasmid to insert TriTag (mCherry) into the N-terminus of human LMNA geneDepositorInsertmCherry-TriTag
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB153 - pL2_pSB90_2x35S::ZCT1::tMAS
Plasmid#123195Purposebinary plant vector for transient expression of ZCT1 from Catharanthus roseusDepositorInsert2x35S::ZCT1::tMAS
ExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB160 - pL2_pSB90_2x35S::ORCA3::tMAS
Plasmid#123196Purposebinary plant vector for transient expression of ORCA3 from Catharanthus roseusDepositorInsert2x35S::ORCA3::tMAS
ExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB166 - pL2_pSB90_tMAS::rLUC-I::pMAS
Plasmid#123199Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron)DepositorInserttMAS::rLUC-I::pMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Zeo-NKX2-8
Plasmid#75090Purposeretrovirus-mediated gene transfer into mammalian cellsDepositorInsertNKX2-8 (NKX2-8 Human)
UseRetroviralTagsnoneExpressionMammalianMutationwild-type, full-length, without native 3' UTRAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-B
Plasmid#64514PurposeAS-30D hepatoma hexokinase II 3.0 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAB806
Plasmid#47849PurposeBIOFAB reporter plasmid for measuring lambda tR2 termination efficiencyDepositorInsertlambda tR2 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO4Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB805
Plasmid#47850PurposeBIOFAB reporter plasmid for measuring tonB termination efficiencyDepositorInserttonB terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO5Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB816
Plasmid#47851PurposeBIOFAB reporter plasmid for measuring ilvGEDA termination efficiencyDepositorInsertilvGEDA
UseSynthetic BiologyExpressionBacterialPromoterpLTetO6Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB807
Plasmid#47852PurposeBIOFAB reporter plasmid for measuring RNAI termination efficiencyDepositorInsertRNAI terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO7Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB820
Plasmid#47855PurposeBIOFAB reporter plasmid for measuring tetAC termination efficiencyDepositorInserttetAC terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO10Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB1910
Plasmid#47859PurposeBIOFAB reporter plasmid for measuring rpoC termination efficiencyDepositorInsertrpoC terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO14Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB804
Plasmid#47848PurposeBIOFAB reporter plasmid for measuring T3 early termination efficiencyDepositorInsertT3 early terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO3Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3905
Plasmid#47808PurposeBIOFAB RFP reporter plasmid for measuring promoter 14 + BCD1 efficiency.DepositorInsertpromoter 14 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
iChr2-Notch Mosaic (SO250)
Plasmid#99752PurposeSecond generation Rosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different chromatin localized fluorescent proteins and Notch signalling genesDepositorInsertHIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD SPI1 P2A mCherry
Plasmid#140031PurposeTunable and temporal expression control of SPI1 and mCherryDepositorAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHyo245
Plasmid#173147PurposeExpresses pheS_A294G by dual T7 promoter in e.coliDepositorInsertpheS_A294G
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro SPI1 P2A mCherry
Plasmid#140029PurposeTunable and temporal expression control of SPI1 and mCherryDepositorAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHyo182
Plasmid#173136PurposeExpresses pheS_A294G in e.coliDepositorInsertpheS_A294G
ExpressionBacterialAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EF1alpha-5' ROBO2
Plasmid#236686Purpose5' AAVLINK plasmid for ROBO2 expressionDepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLPT41
Plasmid#85524PurposeTitration sponge for TetRDepositorTypeEmpty backboneUseSynthetic BiologyPromoterPLtetAvailable SinceApril 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCOLA-A-pC-tac
Plasmid#213494PurposeEncodes Node A of the three-node Turing circuitDepositorAvailable SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRM200U
Plasmid#44529DepositorInsertHHF2-HHT2
ExpressionYeastAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC21
Plasmid#227589PurposeLentiviral plasmid expressing human H2BC21 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMulti_S_ccdB
Plasmid#223853PurposeGEC-acceptor for 4G-cloning, designed for expression in E. coli (Streptomycin resistance)DepositorTypeEmpty backboneUseGolden-gate acceptorExpressionBacterialAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPT145
Plasmid#85527PurposeTitration sponge for TetR, cI and lacIDepositorTypeEmpty backbonePromoterPLtet, PLlac, PRAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only