We narrowed to 4,490 results for: GCA
-
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionAvailable SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWT055g
Plasmid#96864PurposesgRNA-HEK3DepositorInsertsgRNA-HEK3
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
SlugBE4max
Plasmid#163799PurposeExpresses AncBE4max and nSlugCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianMutationSlugCas9 (D10A)Available SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRT2B-GO2
Plasmid#136909PurposeLentivirus expressing GO2 sgRNADepositorInsertsgGO2
UseLentiviralMutationWTPromoterhU6Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR U6-hTERTsh
Plasmid#111385PurposeKnock down of hTERT transcriptDepositorInsertshRNA C3 against hTERT
UseGateway entry cloningPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
LentiGuidPuro-hTP73_sgRNA-1
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 1609
Plasmid#37209DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH1_3
Plasmid#36361DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_3
Plasmid#36370DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS1
Plasmid#140624PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS1. The crRNA-IS1 targets IS1 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS1
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-BlasGO
Plasmid#136906PurposeLentivirus for base editing activatable Blasticidin resistance gene expression in mammalian cells. All in one vector with sgBlasGO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U6SC
Plasmid#134755PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only