We narrowed to 11,847 results for: NSI
-
Plasmid#193129PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3276
Plasmid#193130PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.3
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3271
Plasmid#193121PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.7
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2884
Plasmid#193122PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.2
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3274
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2889
Plasmid#193127PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3272
Plasmid#193134PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "b site" (-210 from TSS).DepositorInsertGB_SynP (A2) G1b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2891
Plasmid#193128PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2885
Plasmid#193123PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3278
Plasmid#193132PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3273
Plasmid#193135PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "e site" (-320 from TSS).DepositorInsertGB_SynP (A2) G1e.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-preSufI(IAC)
Plasmid#168516PurposeModified form of pre-SufI in pET25b. With C-terminal HHHHHHC (6xHisC) extension and mutations C17I and C295A.DepositorInsertpre-SufI(IAC)
Tags6xHisC tag and HSV tagExpressionBacterialMutationC17I and C295APromoterT7Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15 PemrR-gfp biosensor
Plasmid#185793PurposeThe pET15 PemrR-gfp biosensor is transcriptional fusion of GFP with the promoter of the emrRAB operon. This biosensor is responsive to monoaromatics, such as vanillin and syringaldehyde.DepositorInsertpEmrR-gfp
TagsEGFPExpressionBacterialPromoterPemrRAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH1001-Tier2(ColE1 ori)
Plasmid#169599PurposeTier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N3-myc-SLC35A2
Plasmid#186285Purposetransient expression of N-terminal myc tagged SLC35A2 isoform c/UGT1 in mammalian cellsDepositorAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0905
Plasmid#177068PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of gal4AD-phiC31 driven by 35S promoterDepositorInsertgal4AD-phiC31
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12_TP-MpSIG2
Plasmid#136093PurposeChloroplast transit peptide from MpSIG2. For N-term fusion with a CTAGDepositorInsertTP-MpSIG2, Mapoly0214s0004
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEPQD0CM0063
Plasmid#177021PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol synthase
UseSynthetic BiologyMutationtransit peptide removedAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only