We narrowed to 15,978 results for: grna
-
Plasmid#206356PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptorsDepositorInsertNon-targeting control shRNA
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh2-mRFP
Plasmid#170982PurposeEncodes sgRNA scaffold with mRFP in place of target and Kanamycin resistance transposon. New targets can be cloned replacing mRFP using around the horn cloning.DepositorInsertmRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2513
Plasmid#187803PurposeModule for constitutive expression of dCas9:EDLL, Ms2:VPR and a gRNA targeting the DFR promoter.DepositorInsertdCasEV2.1
ExpressionPlantAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3897
Plasmid#187809PurposeModule for dCasEV2.1 activated expression of AtrD11, HarFAR and ScATF1 plus gRNA-1DFR.DepositorInsertMoth Pheromone pathway
ExpressionPlantAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-INS-sg
Plasmid#194719PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hINSDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-MAFB-sg
Plasmid#194718PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hMAFBDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna2
Plasmid#192796PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna2DepositorInsertsgKcna2
UseAAV and CRISPRPromoterU6Available SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna6
Plasmid#192797PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna6DepositorInsertsgKcna6
UseAAV and CRISPRPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
phU6 NFATC2
Plasmid#188708PurposesgRNA plasmid encoding hU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p7SK NFATC2
Plasmid#188710PurposesgRNA plasmid encoding 7SK promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 NFATC2
Plasmid#188711PurposesgRNA plasmid encoding hH1 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEc-crRNA2
Plasmid#170089Purposeencodes E. coli type I-E single spacer arrayDepositorInsertE. coli type I-E single spacer array
UseCRISPR and Synthetic BiologyPromoterJ23119Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSmg7
Plasmid#161809Purposeguide RNA for Smg7DepositorInsertsgRNA targeting mouse Smg7 (Smg7 Mouse, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP2373
Plasmid#160079PurposeZ. mobilis CRISPRi, promoter F, empty guide, sfGFPDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2371
Plasmid#160078PurposeZ. mobilis CRISPRi, promoter E, empty guide, sfGFPDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2369
Plasmid#160077PurposeZ. mobilis CRISPRi, promoter D, empty guide, sfGFPDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2093
Plasmid#160074PurposeZ. mobilis CRISPRi, promoter B, empty guide, sfGFPDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only