We narrowed to 167,150 results for: Gene
-
Plasmid#124415PurposeSlot A, empty (step 1)DepositorInsertslot A + terminator + spacer
ExpressionBacterialAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-0_v3
Plasmid#124423PurposeFull MCS (step 2)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
yCp50-PRP5
Plasmid#111303PurposePrp5 in yCp50 plasmidDepositorInsertPRP5
ExpressionYeastAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCVD002
Plasmid#63688Purposefor use in sequencing and mapping of the V. cholerae enterotoxin genesDepositorInsertenterotoxin genes
ExpressionBacterialAvailable SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC120
Plasmid#50350PurposepUC cloning vectorDepositorTypeEmpty backboneUseCloning vectorAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRM430
Plasmid#44530DepositorInsertHHT2
ExpressionYeastMutationhht2 deletion 4-30Available SinceJune 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRM415
Plasmid#44526DepositorInsertHHT2
ExpressionYeastMutationhht2 deletion 4-15Available SinceMay 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
UAS-rhophilin
Plasmid#41974DepositorInsertrhophilin
ExpressionInsectPromoterHsp70Available SinceFeb. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
FC511
Plasmid#27330DepositorAvailable SinceFeb. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGC291
Plasmid#19684DepositorInsertPhlh-12
UseGateway entry cloneExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC450
Plasmid#19691DepositorInsertPhlh-12
UseGateway entry cloneExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC451
Plasmid#19692DepositorInserthlh-12_coding region
UseGateway entry cloneExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC81
Plasmid#19688DepositorInserthlh-12_genomic region
ExpressionWormAvailable SinceMarch 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC85
Plasmid#19689DepositorInserthlh-12(R15K)_genomic region
ExpressionWormAvailable SinceMarch 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
RCAS(B) En cRaxL deltaC (CC#523)
Plasmid#15196DepositorInsertRaxL
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
RCAS(B) En cRaxL HD (CC#520)
Plasmid#15197DepositorInsertRaxL
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-45: TTN-mEGFP
Plasmid#114412PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TTN, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertTTN Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TTN Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro-mCherry2
Plasmid#219679PurposeCROPseq vector based on #86708 with an additional mCherry2 fluorescent geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEF1a-Puro-P2A-mCherry2-WPRE-hU6-gRNAExpressionMammalianAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS-SceI
Plasmid#137725PurposeLentivirus reporter assay plasmid that contains a I-SceI site and a EGFP reporter gene.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSncg-EGFP
Plasmid#153198PurposeHuman gamma-synuclein (hSncg) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB167 - pL2_pSB90_2x35S::fLUC-I::tNOS_tMAS::rLUC-I::pMAS
Plasmid#123200Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron) and a firefly luciferase (fLUC, with intron) in plantsDepositorInsert2x35S::fLUC-I::tNOS tMAS::rLUC-I::pMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral mBmal1-Luc
Plasmid#182762PurposeLentiviral vector encoding the promoter region of mouse Bmal1 gene driving a luciferase reporterDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK068.CAG-FRT-stop-FRT-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85008PurposeFor Flpe/FRT-based Supernova-GFP, pK068 should be used with pK036. The GFP fragment of pK068 can be replaced with another gene by SalI and EcoRV.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pK038.CAG-loxP-stop-loxP-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85006PurposeFor Cre/loxP-based Supernova-GFP, pK038 should be used with pK031. The GFP fragment of pK038 can be replaced with another gene by using SalI and EcoRV sites.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAG∞MCS
Plasmid#154013PurposeExpression vector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019), equipped with an MCS to clone-in genes of interest and express it from a CAG promoterDepositorInsertMCS
ExpressionMammalianPromoterCAGAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSyn1-EGFP
Plasmid#153205PurposeHuman synapsin-1 (hSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFOS WT-GL3
Plasmid#11983PurposeReporter gene with mouse c-fos promoter. Induced by serum and many growth factors in quiescent cells.DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-hCD4
Plasmid#162746PurposeNFAT-driven ZsGreen-1 reporter gene with human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHDR_sox2HA_P2A-GFP-pA_HA_G2913A
Plasmid#196191PurposeTagging human SOX2 gene with P2A-EGFP at the C-terminusDepositorInsertSOX2-HAL-P2A-EGFP-SOX2-HAR (SOX2 Human)
UseHomology repair donorMutationG2913A mutation to replace the guide cutting site…Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV-opEBNA2-IRES-mCherry
Plasmid#220355PurposeExpresses EBV latent gene EBNA2 in mammalian cells (EBNA2 coding sequence was optimised for expression)DepositorInsertopEBNA2 (EBNA-2 Epstein-Barr Virus (EBV) strain B95-8)
UseRetroviralExpressionMammalianMutationcodon-optimised for expression in mammalian cellsAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-EGFP
Plasmid#153163PurposeMouse gamma-synuclein (mSncg) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromotermSncgAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPORT1[attB/Ins1/NbT promoter/glGFP/bglobin 3'-UTR/Ins2]
Plasmid#74102Purposeplasmid driven under neuronal beta-tubulin promoter, bearing attB and two insulator sequences (opposite directions pointing inward towards the reporter gene)DepositorInsertsXenopus laevis beta-tubulin gene promoter region and 5'UTR
Green Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
ExpressionBacterialAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega1_KanR_BastaR
Plasmid#186426Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)DepositorInsertsKanR
BastaR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYTRW09K_0T5
Plasmid#177281Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-E
Plasmid#67509PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type E envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type E
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pY30
Plasmid#84745PurposeExpresses huAsCpf1-P2A-puro and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLgw RFC1-V5-EcoDam
Plasmid#59205PurposeMammalian DamID lentiviral vector for fusing gene of interest with Dam-V5 using Gateway cloningDepositorTypeEmpty backboneUseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYTRW26K_1Ti1
Plasmid#177292Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and eYFPDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only