-
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable sinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL537
Plasmid#49945PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-4 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertRHOXF2 Rhox homeobox family member 2 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonTagsExpressionMammalianMutationPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable sinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-1 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL535
Plasmid#49941PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-2 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertRHOXF2 Rhox homeobox family member 2 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP-FMRP-bGH
Plasmid#235265PurposeComMAND EGFP-FMRP base geneDepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseSynthetic BiologyTagsFLAGExpressionMammalianMutationPromoterEF1a (human EF1a)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-TAZ-CAMTA1
Plasmid#235679PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the CMV promoterDepositorUseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1a and U6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hIsl2-EGFP
Plasmid#153206PurposeHuman Isl2 (hIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorInsertSAFB (Safb Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorInsertSAFB (Safb Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#199450PurposeCRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor)
Plasmid#199451PurposeCRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR regionDepositorInsertHDR donor template
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor)
Plasmid#199452PurposeCRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…ExpressionMutationPromoterAvailable sinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mIsl2-EGPF
Plasmid#153191PurposeMouse Isl2 (mIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL542
Plasmid#49951PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-8 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
SL544
Plasmid#49970PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-10 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL545
Plasmid#49953PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-11 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL543
Plasmid#49952PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-9 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL541
Plasmid#49950PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-7 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL540
Plasmid#49949PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-6 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EGFP
Plasmid#16542DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJFRC12-10XUAS-IVS-myr::GFP
Plasmid#26222DepositorInsertmyr::GFP
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLZts
Plasmid#128799PurposeTemperature-sensitive vector for allelic replacement mutagenesis of Group A StreptococcusDepositorTypeEmpty backboneUseBacterial mutagenesisTagsExpressionMutationPromoterAvailable sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJFRC19-13XLexAop2-IVS-myr::GFP
Plasmid#26224DepositorInsertmyr::GFP
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLPT107
Plasmid#85525PurposeRepressilator with triple reporterDepositorInsertsmCfp
mVenus
tetR
lacI
cI
mKate2
UseSynthetic BiologyTagsssrAExpressionBacterialMutationPromoterAvailable sinceApril 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-20XUAS-IVS-mCD8::GFP
Plasmid#26220DepositorInsertmCD8::GFP
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorTagsExpressionMutationPromoterlacZAvailable sinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-NlucP
Plasmid#162595PurposeC-terminally PEST-tagged NanoLuc under TRE3G promoterDepositorInsertNanoLuc-PEST
UseTagsPESTExpressionMammalianMutationPromoterTRE3G promoterAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKEN GFP mut2
Plasmid#20409DepositorInsertGFP
UseTagsExpressionBacterialMutationS65A V68L S72APromoterAvailable sinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
lacI-PT5-gusA-pBAV1k
Plasmid#30501DepositorInsertbeta-glucuronidase (gusA Escherichia coli)
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Gateway
Plasmid#32671DepositorTypeEmpty backboneUseAAV; AavTagsExpressionMutationPromoterAvailable sinceJune 29, 2012AvailabilityAcademic Institutions and Nonprofits only