-
Plasmid#107329PurposeU6 driven NmCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRTagsExpressionMutationPromoterU6Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330A_dCas9-1x5
Plasmid#63599PurposeExpresses dCas9 and gRNADepositorInserthumanized S. pyogenes dCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBLO43.3_human ProCas9Flavi
Plasmid#121629PurposeU6-sgRNAdest_CMV-intron_hProCas9Flavi_T2A Mcherry_AmpR_ColE1DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-casBCDE(+6)
Plasmid#89728PurposeExpresses the Cascade subunits Cse2, Cas7, Cas5, Cas6e and pre-crRNA containing a longer version of the wt spacer (+6) extended by 6 nucleotides at the leader-distal end.DepositorInsertCRISPR array
UseTagsExpressionBacterialMutationDerivative CRISPR array containing a longer versi…PromoterAvailable sinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcasper4 p [8-Gr66a+]
Plasmid#26862DepositorInsertGr66 gustatory receptor (Gr66a Fly)
UseTagsExpressionInsectMutationContains Gr66a and neighboring genes CG7066 and C…PromoterAvailable sinceMay 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9noSsrA
Plasmid#102285PurposeModified from pCas9-CR4 (Addgene: 62655) to remove the ssrA tag from Cas9.DepositorInsertCas9
UseCRISPRTagsExpressionBacterialMutationremoved ssrA tagPromoterpTetAvailable sinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A_dCas9-1x3
Plasmid#63597PurposeExpresses dCas9 and gRNADepositorInserthumanized S. pyogenes dCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTaCas9-H840A_5
Plasmid#91172PurposeCas9 only expression, Cas9 Type: TaCas9_H840A (nickase), Plant Selection: PvUbi2:hpt IIDepositorInsertTaCas9_H840A (nickase)
UseCRISPRTagsExpressionPlantMutationH840APromoterAvailable sinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTaCas9-D10A_6
Plasmid#91171PurposeCas9 only expression, Cas9 Type: TaCas9_D10A (nickase), Plant Selection: PvUbi2:barDepositorInsertTaCas9_D10A (nickase)
UseCRISPRTagsExpressionPlantMutationD10APromoterAvailable sinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-D10A_3
Plasmid#91161PurposeCas9 only expression, Cas9 Type: AtCas9_D10A (nickase), Plant Selection: 2x35S:barDepositorInsertAtCas9_D10A (nickase)
UseCRISPRTagsExpressionPlantMutationD10APromoterAvailable sinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD10AH840AhCas9 (GB1041)
Plasmid#68207PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid partDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removed; human codon optimis…PromoterAvailable sinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
helicase cDNA
Plasmid#39552DepositorInserthelicase (Hel25E Fly)
UseTagsExpressionMutationPromoterAvailable sinceJan. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
RCAS (A) cPitx1 (CT#70)
Plasmid#13871DepositorInsertpitx1 (PITX1 Chicken)
UseRetroviral; Avian expressionTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-hs-taiman
Plasmid#17585DepositorInserttaiman (tai Fly)
UseTagsExpressionInsectMutationPromoterAvailable sinceNov. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only