We narrowed to 959 results for: Gatc
-
Plasmid#83440PurposeExpresses Cas9 and a gRNA targeting SMCR8DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pU6_(Gluc)_INT(GenPurpClon)
Plasmid#68433PurposeGeneral Purpose cloning vector for "INT"-like constructs under U6-promoter expression.DepositorInsertINT construct
UseCRISPR; Cloning vector for generating int-like co…ExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_TOP1
Plasmid#68434PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLJM60-S6K1(wt) barcoded
Plasmid#48801Purposeexpresses wt S6K1DepositorInsertS6K1 (Rps6kb1 Rat)
UseLentiviralTagsFLAG and barcode: GGATCCExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 mUlk1 (wt) barcoded
Plasmid#48799Purposeexpresses wt Ulk1DepositorInsertULK1 (Ulk1 Mouse)
UseLentiviralTagsFLAG and barcode: GGATCCExpressionMammalianPromoterCMVAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3B
Plasmid#183284PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3B geneDepositorInsertDNMT3B
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2-GW/EmGFP-miR-SUMO23
Plasmid#31073DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-shTACC3
Plasmid#59355PurposeKnocks down TACC3 in mammalian cells via shRNA and co-expresses GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 2
Plasmid#131346PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_TOP1
Plasmid#68437PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[Spinach2]
Plasmid#68430PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "Spinach2" aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the "Spinach2" aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_TOP2
Plasmid#68435PurposeTransient expression of the "TOP2" construct, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertTOP2 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lsg-LRRK2-1
Plasmid#199277Purposenicking sgRNA to induce LRRK2 (c. 6055 G > A) mutation using PE3DepositorInsertLRRK2 nick
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRbm10/Cre
Plasmid#89648PurposeExpresses an Rbm10-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_TOP1
Plasmid#68423PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR1
Plasmid#183289PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR1 geneDepositorInsertFGFR1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ABL2
Plasmid#183268PurposeAll-in-One CRISPRko system with a guide RNA that targets ABL2 geneDepositorInsertABL2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
shCDK6(2)
Plasmid#73553PurposeshRNA(2) against CDK6DepositorInsertshRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[GFPApt]
Plasmid#68428PurposeTransient expression in mammalian cells of an "INT" construct_bearing the GFP aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the GFP aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xK-T]
Plasmid#68429PurposeTransient expression in mammalian cells of an "INT" construct_bearing three kink-turns, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing three kink-turns
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA3717
Plasmid#240491PurposeCRISPRi-mediated Knockdown of RPA3717DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 1
Plasmid#193595PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 1 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 2
Plasmid#193596PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 2 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-T#1
Plasmid#171515Purposedeletion of a genomic locus in T(Brachyury) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-PosCon
Plasmid#183553PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio positive control (Pbrm1), Figure S2)DepositorInsertPbrm1 shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK1
Plasmid#183302PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK1 geneDepositorInsertJAK1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLY133
Plasmid#130961PurposeEngineered sgRNA-LEB4 generator including Anderson promoter J23100 for golden gate assemblyDepositorInsertsgRNA-LEB4
UseSynthetic BiologyExpressionBacterialPromoterAnderson promoter J23100Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only