We narrowed to 14,983 results for: GRN
-
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-BAR
Plasmid#126072PurposeFor CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoter35S for BAR; Rice UBI for Cas9; Rice snoRNA U3 fo…Available SinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
act-AsCpf1
Plasmid#73917Purposeexpression plasmid of AsCpf1DepositorInserthAsCpf1
TagsNLS-3xHAExpressionInsectPromoteract5CAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOsU3
Plasmid#170132PurposeFor sgRNA expression in monocotyledons protoplastsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
sh-RNA hAtg13
Plasmid#31971DepositorAvailable SinceSept. 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-LNGFR-FF3
Plasmid#11666Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of LNGFR and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsLNGFRExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKD3.RNAi
Plasmid#10818DepositorAvailable SinceOct. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMB60
Plasmid#47941PurposeCan be used to generate synthetic guide in vitro from T7 promotorDepositorInsertsynthetic guide RNA
UseCRISPRExpressionWormAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway CloningAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-FOXM1-shRNA-81
Plasmid#89495PurposeLentiviral vector with constitutive expression of shRNA targeting human FOXM1.DepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-enRhCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197027PurposeVector encoding a human codon-optimized enRhCas12f1 driven by CBh promoter, guide RNAs compatible with enRhCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized enRhCas12f1
ExpressionMammalianMutationL270RPromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEM320 - sgRNA mosTI unc-119 array insertion
Plasmid#159824PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 array insertion
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgKEAP1-2
Plasmid#186459Purposeknock out KEAP1 in mammalian cellsDepositorInsertKeap1 (Kelch-like ECH-associated protein 1) (KEAP1 Human)
UseCRISPR and LentiviralAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 3782
Plasmid#31979DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS-puro shNEDD4L #1
Plasmid#27016DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetro-EFP siRNA2
Plasmid#12450DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only