We narrowed to 4,936 results for: AAT
-
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUT1393-HQ858725
Plasmid#27775DepositorInsertCCAAT-HAP3 transcription factor from EE177028
UseEntry vectorAvailable SinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUT1431-HQ858733
Plasmid#27815DepositorInsertCCAAT-HAP5 transcription factor from DT647007
UseEntry vectorAvailable SinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUT1461-HQ858752
Plasmid#27834DepositorInsertCCAAT transcription factor from DR965925
UseEntry vectorAvailable SinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUT1497-HQ858755
Plasmid#27837DepositorInsertCCAAT1-Dr1 transcription factor from EB705687
UseEntry vectorAvailable SinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutB
Plasmid#13499DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D377Y-mPCSK9
Plasmid#58376PurposeExpresses GoF mutant murine PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (Pcsk9 Mouse)
UseAAVExpressionMammalianMutationD377YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_6
Plasmid#163460Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD1_1
Plasmid#160773PurposeSuppress CISD1DepositorInsertshCISD1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
HeLa full-length MLCK-GFP
Plasmid#46316DepositorInsertHeLa long myosin light chain kinase (MYLK Human)
TagsGFPExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD2_1
Plasmid#160775PurposeSuppress CISD2DepositorInsertshCISD2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-RPA194
Plasmid#247352PurposeExpresses SpCas9 and a sgRNA targeting the human RPA194 loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2842C
Plasmid#139324PurposePlasmid expressing a sgRNA to introduce BRCA2 R2842C using base editingDepositorInsertsgRNA to insert BRCA2 R2842C using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NBRE3
Plasmid#208254PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cellsDepositorInsert3X NBRE-LUC
ExpressionMammalianPromoterSV40 early promoterAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-XPO1-ts1
Plasmid#174286PurposeXPO1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NurRE3
Plasmid#208253PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NurRE POMC promoter DNA response element (5′-GATCGTGATATTTACCTCCAAATGCCA- 3′) used for luciferase reporter assays in mammalian cellsDepositorInsert3X Nur response element LUC
TagsNoExpressionMammalianPromoterSV40 early promoterAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Hsa
Plasmid#128175PurposeDoxycyclin inducible shRNA knockdown of human cGAS geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D374Y-hPCSK9
Plasmid#58379PurposeExpresses GoF mutant human PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorInsertproprotein convertase subtilisin/kexin type 9 (PCSK9 Human)
UseAAVExpressionMammalianMutationD374YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA beta-catenin
Plasmid#18803Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expressionDepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDHODH-4
Plasmid#186022Purposeknock out DHODH in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
SPHK2 gRNA (BRDN0001148465)
Plasmid#77093Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-1
Plasmid#193702PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRKAG3 gRNA (BRDN0001146704)
Plasmid#77294Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLA1_1
Plasmid#160789PurposeSuppress POLA1DepositorInsertshPOLA1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
SOX17-3'gRNA
Plasmid#210465PurposegRNA targeting SOX17 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertSOX17 (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-C9orf72
Plasmid#83439PurposeExpresses Cas9 and a gRNA targeting C9orf72DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shQKI-3373
Plasmid#115456PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.2#2/Cre
Plasmid#173661PurposeExpresses a NT.2-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only