We narrowed to 11,576 results for: Kars
-
Plasmid#12744PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf56
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf57
Plasmid#12745PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf57
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf58
Plasmid#12746PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf58
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf59
Plasmid#12747PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf59
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf60
Plasmid#12748PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf60
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
dCas9-VPR_P2A_mCherry
Plasmid#154193PurposeLentiviral expression plasmid encoding dCas9-VPR and a P2A linked mCherry markerDepositorInsertsp-dCas9-VPR_P2A_mCherry
UseLentiviralExpressionMammalianMutationD10A, H840APromoterEF1asAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACT2-DdtS-HsMCU
Plasmid#253519PurposeD.discoideum targeting sequence with C-terminal tagged HsMCU mature protein in pACT2 vectorDepositorAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 - FLAG(Cterm)- HsMCU, 261A, 264A
Plasmid#253539PurposeExpresses C-terminal FLAG tagged HsMCU with Amino Acid at 261 and 264 changed to ADepositorAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(mem).iGlucoSnFR2.mRuby3
Plasmid#244097PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-hMLH1NTD-NLS
Plasmid#174826PurposeMammalian expression of human MLH1NTD-NLS (codon optimized)DepositorInserthuman MLH1_NTD-NLS (codon optimized)
TagsSV40 bpNLSExpressionMammalianMutationtruncation of residues 1-335PromoterEF1aAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244099PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9.mCherry
Plasmid#208342PurposeLentivirus with EF1a driven Cas9 linked (P2A) to mCherry.DepositorArticleInsertsCas9
mCherry
UseCRISPR and LentiviralTagsnuclear localization sequence (NLS) and FLAG tagPromoterEF-1aAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pY002 (pFnCpf1_min)
Plasmid#69975PurposeExpresses FnCpf1 and spacers 1-4 of CRISPR array under artificial promoter. Cas genes are removed.DepositorInsertFnCpf1 locus without Cas genes nd artificial promoter
UseCRISPRExpressionBacterialAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hSYN-MYC-MIRO1
Plasmid#219577PurposeLentiviral construct expressing MYC-tagged human Miro1DepositorAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNP3425 [pNP2922 - ISCro4 Enhanced bRNA (TBL4, WT + DBL3, WT) + ISCro4 Recombinase (WT)]
Plasmid#247262PurposeExpress ISCro4 recombinase and bridge RNADepositorInsertpNP2922 - ISCro4 bRNA1-179 C60U, A61G, U73C, dU86, A87G, dU88, ins179(rc(101-111) (TBL4+DBL3)
ExpressionMammalianMutationC60U, A61G, U73C, dU86, A87G, dU88, ins179(rc(101…Available SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag Jnk1a1(apf)
Plasmid#13846DepositorInsertJnk1a1(apf) (MAPK8 Human)
TagsFlagExpressionMammalianMutationreplaced dual phosporylation motif Thr(183)-Pro-T…Available SinceFeb. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDY1173_ADAR1p150
Plasmid#193192PurposeExpress full length ADAR1p150DepositorInsertADAR1p150 (ADAR Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MEF2D-2A-neo
Plasmid#190622PurposeLentiviral expression plasmid of human MEF2D (long isoform), neomycin selectionDepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAT FAK biosensor
Plasmid#78303PurposeFRET biosensor. Visualization of FAK activity at focal adhesions in live cellsDepositorInsertFAT FAK biosensor
ExpressionMammalianPromoterCMVAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNP3386 [For use in genome insertion and off-target assessment]
Plasmid#247258PurposeExample plasmid for bridge recombinase mediated insertion and off-target assessment with puromycin selection — must clone in UMIDepositorInsertISCro4 Recognition Site-UMI-Ef1a-PuroR-P2A-mCherry (Plasmid for Insertion Site Mapping [Example, Clone in Sequence + UMI])
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBbA5a-sufABCDSE
Plasmid#195056PurposeExpresses SUF operon from E. coli from IPTG-inducible promoterDepositorInsertsufABCDSE
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBbA5a-sufCDSUB
Plasmid#195055PurposeExpresses SUF operon from B. subtilis from IPTG-inducible promoterDepositorInsertsufCDSUB
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NANOS3-T2A-mVenus-PuroTK
Plasmid#222903PurposeHomology directed repair template for knocking in mVenus reporter to NANOS3.DepositorInsertmVenus
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
3HA-ERHBH-HoxA7
Plasmid#253603PurposeRetroviral expression vector for 3HA-ERHBD-Hoxa7DepositorAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-FLAG-CRBN-pGK-HYG
Plasmid#107374PurposeLentiviral expression of FLAG-CRBNDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP
Plasmid#46910PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFPDepositorInsertdCas9-BFP fusion
UseCRISPR and LentiviralTags2xNLS, BFP, and HAExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Frb-v1
Plasmid#201923PurposeE. coli vector expressing FrbA, FrbB, FrbC, FrbD and FrbE for the biosynthesis of non-hydrolyzable phosphoserine from phosphoenolpyruvate.DepositorInsertsFrbA
FrbB
FrbC
FrbD
FrbE
ExpressionBacterialPromoterT7 (modified), T7 (modified, moderate), T7 (modif…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-CRBN-pGK-HYG
Plasmid#107380PurposeMammalian expression of FLAG-CRBNDepositorAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEFIRES-P-ACSL3-mCherry
Plasmid#87158PurposeFluorescent protein targeted to lipid droplets (LDs) from the endoplasmic reticulum (ER)DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-EGFP-T2A-RPL22-1xFlag
Plasmid#170323PurposeExpresses FLAG and EGFP tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21b GFP-Rab10 Q68LHis
Plasmid#186015PurposeGFP-Rab10 Q68LHisDepositorInsertGFP-Rab10 Q68LHis (RAB10 Human)
ExpressionBacterialAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244084PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-ATF5-PROX1-HNF1A
Plasmid#149725Purposeexpressing three liver promoting transcription factors (ATF5, PROX1, HNF1A)DepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SFRS2IP
Plasmid#156012PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P REV3L_1
Plasmid#160797PurposeSuppress REV3LDepositorInsertshREV3L_1
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(mem).iGlucoSnFR2.mRuby3
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_2
Plasmid#160780PurposeSuppress DNA2DepositorInsertshDNA2_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_1
Plasmid#160779PurposeSuppress DNA2DepositorInsertshDNA2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDest17_MAX
Plasmid#234044PurposeBacterial expression of N-terminally 6His-tagged MAX; includes TEV cleavage siteDepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFG.wtCNa_opt.IRES.eGFP
Plasmid#22489DepositorInsertcodon optimised wild type Calcineurin A (PPP3CA Human)
UseRetroviralMutationCodon Optimised wtCNaAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP VAMP3
Plasmid#42310DepositorAvailable SinceFeb. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-ETV2
Plasmid#225051PurposePiggyBac vector encoding doxycycline-inducible codon-optimized human ETV2DepositorInsertETS Variant Transcription Factor 2 (ETV2 Human)
ExpressionMammalianMutationCodon OptimizedPromoterTRE3GAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only