We narrowed to 784 results for: SCR;
-
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental considerations,...
-
Adenovirus Plasmids
TypeCollection...strains for generating adenovirus. ID Strain Description PI 16398 BJ5183 Strain for recombination between... plasmids that have inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining... be assembled in a one-tube reaction. ID Kit Description PI 1000000176 AdenoBuilder toolkit Plasmids contain... -
Distribution to Industry
TypeCollection...Plasmid Gene/Insert PI Kits Kit name Type PI Description High Complexity Golden Gate Assembly Standards...Pooled Libraries Pooled Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten...exon 5–8. Phagemid Synuclein VHH Immune Library Screening Messer and MJFF Created for research in Parkinson's... -
Validated gRNA Sequences
TypeCollection...the particular conditions of the experiment as described in the associated article (listed below by PubMed...within promoters. When possible, the categories described on Addgene's CRISPR Plasmids and Resources page...GCGGCAGCTCCTAGCTCAGC 61515 nick S. pyogenes 25569111 Hanna mitf S. scrofa CTTTCGGATATAATCCACGG 69801 cut S. pyogenes 26293209...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere... -
Brain Armamentarium
TypeCollection...below. Plasmids ID Plasmid Description PI Viral Preps ID Viral Prep Description PI (Cargo) PI (Capsid) 230681...labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting Viviana Gradinaru... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...research, you can get advice from GCE experts by subscribing to the GCE bulletin board (GCEbb) listserve and...non-standard amino acid incorporation. ID Strain Description PI 48998 C321.ΔA all TAG sites changes to UAG... -
Fluorescent Protein Guide: Activity Regulation
TypeCollection...activity. Early tools allow scientists to regulate transcription, and additional tools are being developed to...Principal Investigator Plasmids GFP GFP-dependent transcription factors Connie Cepko See Plasmids Dronpa Optical... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Back to... plasmids from this depositor's lab. Plasmid Description Vector Type Selectable Marker PI Publication ... -
Brain Initiative Collection
TypeCollection... with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...Learn more about our viral service ID Viral Prep Description PI 65417-AAV8 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine...labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - Parasites
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Chemogenetics Plasmids
TypeCollection...opto-chemogenetic actuator. For more detailed descriptions of chemogenetic receptors, ligands, and how ...preparations of many chemogenetics plasmids. ID Plasmid Description Gene/Insert Vector Type Promoter Tags Eligible... -
Resolute Plasmid Collection
TypeCollection...pooled libraries are useful tools for genetic screening experiments. These libraries target the solute...solute carrier family of proteins. Library ID PI Description Human SLC Activation Library 132561 Superti-Furga... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...10.1038/nprot.2009.98. Epub 2009 Sep 17. PubMed . Description Use of the OPEN method requires OPEN pools (available...using the bacterial two-hybrid system originally described by Hochschild and colleagues ( Dove et al., Nature... -
Serotype Testing AAV
TypeCollection...Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in various serotypes suitable... Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV in various serotypes suitable... -
Addgene Packaged on Request: Scope of Service
TypeCollection...been completed at the time of shipment. If any discrepancies are identified during this analysis, you will... that we will not meet the turnaround time we described here or by email, Addgene will contact you to ... -
Synthetic Biology - Overview
TypeCollection...Voigt Clifford Wang Ron Weiss Synthetic biology describes the rational engineering of biological systems...and pOSIP Plasmid Kit Gray Lab Maize and Rice Transcription Factors Hasty Lab Biopixels Jaramillo Lab Riboregulation... -
AAV for Neuronal Tracing
TypeCollection...Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...glycoprotein (G) gene, which is not required for the transcription or replication of the genome within infected... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...label of their choice according to the methods described by George et al. (2004). The ACP and SFP Synthases...respectively) may be expressed and purified as described previously in Stachelhaus et al. (1998) References... -
Antibody Plasmid Collection
TypeCollection...create and express plasmid-based antibodies. Description Article PI One-step assembly of antibody heavy...for "anti-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions... -
mTOR Pathway
TypeCollection... Tackling Cancers’ Drug Resistance with a New Screening Kit Background mTOR Pathway Plasmids mTOR Gene... Tackling Cancers’ Drug Resistance with a New Screening Kit (from David Sabatini & Kris Wood) References... -
Promega Plasmid Collection
TypeCollection... in a new window) on Promega.com. ID Plasmid Description Industry Plasmid Technology Overview This collection...editing outcomes, and conducting high-throughput screening in drug discovery. NanoLuc Fusions NanoLuc (Link... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...plasmid). Helper Plasmid ID Plasmid Serotype Description PI 112867 pAdDeltaF6 All Helper plasmid for AAV...Packaging Service at Addgene ID Plasmid Capsid Description PI 112862 pAAV2/1 AAV1 AAV packaging plasmid,... -
Lentivirus Plasmids
TypeCollection...lentivirus technologies. ID Plasmid Generation Type Description PI 12253 pRSV-Rev 3rd Packaging Contains Rev;...table and search "lenti". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty... -
Neurodegeneration Research Collection
TypeCollection...blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons function...PiggyBac plasmids with tet-inducible expression of transcription factors for sensory, motor, and cortical neuron... -
Synthetic Biology - Browse Plasmids
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication... -
Synthetic Biology - Algal
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Bacterial
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Fungal
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Mammalian
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Plant
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Worm
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Synthetic Biology - Yeast
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Do you... -
Tags and Other Markers
TypeCollection...our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity Recommended... -
Synthetic Biology - Strains
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Antibiotic Resistance PI Publication... -
Neuroscience
TypeCollection...our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity Recommended... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...Browse or search the table below. ID Plasmid Description Gene/Insert Industry PI Return to top... -
Zinc Finger Consortium Reagents
TypeCollection...and educational use. Links to additional pages describing these reagents are provided below: Zinc Finger... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection...types, as noted in the purpose field: ID Plasmid Description Additional Resources iNDI (Link opens in a new... -
Impact of Genomic Variation on Function (IGVF) Consortium Collection
TypeCollection...their plasmid tools through Addgene. ID Plasmid Description Vector Type PI Publication Additional Resources... -
TALEN Expression Vectors
TypeCollection...cell expression and a T7 promoter for in vitro transcription of RNA. TALENs expressed from these vectors ... -
Individual REAL TALE Repeat Plasmids
TypeCollection...Daniel Voytas Lab plasmids The Joung Lab recently described a rapid and robust protocol for constructing TALE... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...Truncated for making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Addgene Resources... -
Fluorescent Protein Guide
TypeCollection...proteins to modulate biological activity, like transcription. Michael Davidson FP Collection Browse the Michael... -
DNA Service - Cloning Grade DNA
TypeCollection...Plasmids Available as Cloning Grade DNA ID Plasmid Description Industry PI FAQ What Quality Control analyses... -
All Antibodies
TypeCollection...Browse All Antibodies ID Recombinant Antibody Description Source Species Isotype Reactivity Recommended...