...protein) in striatal Pvalb+ neurons. Note strong cortical Pvalb and L5 ET neuron expression. Jonathan Ting.... AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core...Expression of CoChR-EGFP in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214862-PHPeB AiP14825...Expression of iCre(R297T) in striatal medium spiny neurons Jonathan Ting Viviana Gradinaru 214858-PHPeB AiP14496...separate nuclear FLAG epitope in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214857-PHPeB AiP14361...jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan Ting Viviana Gradinaru 214856...jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan Ting Viviana Gradinaru 214853...

... cheap and accessible) to massive transmission electron microscopes that allow us to see cellular components...

...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8...

...Bacterial Expression Dronpa3 503 518 19 Monomer Dronpa3-N1 - Mammalian Expression Dronpa3-C1 - Mammalian Expression... 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression Topaz 514 527 57 Prone to dimerization...35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone to dimerization...Many FPs are monomers at low concentration but are prone to dimerization at high concentration, so this is...Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1 - Mammalian Expression...-C1 - Mammalian Expression Azurite 383 450 14 5 Prone to dimerization pLV-Azurite - Mammalian Lentiviral...-C1 - Mammalian Expression EBFP2 383 448 17 4.5 Prone to dimerization pBad-EBFP2 - Bacterial Expression...

...Background Information Anatomy of a Pipette This front view photo of a P1000 pipette shows the plunger ...

...window) Cummings KA, Clem RL. 2020. Prefrontal somatostatin interneurons encode fear memory. Nat Neurosci...to single-component cellular definitions (e.g. neurons defined by a single gene or projection). Intersectional...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...

... for utilizing SHERLOCK to detect coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access...DETECTR to detect coronavirus - A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using... Medicine Coronavirus webpage PLOS Journals COVID-19 Collection Science Journals Coronavirus Collection... for Coronavirus research. Collections... Collections COVID-19 - Plasmids and Resources COVID-19 and Coronavirus Plasmids...knowledge and understanding of COVID-19 and related coronaviruses. To assist with this effort Addgene will maintain... may be of use to scientists. Background The Coronavirus Disease-2019 (COVID-19) pandemic is caused by...

...and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to limb ...progressive degeneration and ultimate death of neurons. Common neurodegenerative diseases include Alzheimer...CRISPR screens to understand more globally how neurons function. They are also delving into new technologies...polyglutamine sequences. These glutamine-rich sequences are prone to misfolding and aggregation and can interfere ...Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive neurological disorder that primarily...the malfunction and death of dopamine-producing neurons in the substantia nigra, one of the movement control...control centers in the brain. The cause of this neuron death is unknown. Despite the idiopathic (having...

...product is the anticipated size and that your band is strong (indicating that the PCR reaction worked and that...

...If the samples are running unevenly and the dye front looks like a “smile”, reduce the voltage. Turn off...

...transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G...transgene expression, contains intron that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven...plasmids along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase...transfer plasmids along with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev...used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag...under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression of...about cloning & additional plasmids. Aebischer and Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 ...

...targeted neuronal manipulation. Topics may include: How this technology is used for targeted neuronal manipulation...Series AAV Technologies and Methods for Targeted Neuronal Manipulation Meeting Date September 21, 2018 Contact... AAV-based molecular tools to achieve targeted neuronal manipulation (aka intersectional control). The...fit in the big picture of methods for targeted neuronal manipulation? Best practices for using this techonology... is presenting on) is used to achieve targeted neuronal manipulation. Figures, tables, data, or images...communication representing a reference for AAV use in neuronal intersectional control. Through your participation...Adeno-Associated Virus Technologies and Methods for Targeted Neuronal Manipulation. Haery L, Deverman BE, Matho KS, ...

...pLOX-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (BglII...newborn neurons Retroviral Luikart 66693 pRubiG-T2A-cre GFP and Cre expression in newborn neurons Retroviral...CREM (or Cre-M) has been engineered to contain an intron, preventing Cre expression when cloning in E. coli...including the polyadenylation site and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER...AAV Aebischer 24704 GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre and shRNA coexpression...pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre iCre CAG ...AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA...

...Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle ...expression constructs available that are driven by a strong constitutive promoter and can be used to monitor...so both Renilla and Firefly luciferase contain introns Anthony Leung 141285 pGWB401NL3F10H NanoLuc® Creation...Top Expression Constructs Luciferase driven by a strong constitutive promoter and can be used to monitor...firefly luciferase Scott Lowe 14080 pAKlux2 Lux Operon Bacterial expression of luciferase from broad host...expression of firefly luciferase and iRFP720 from a bicistronic promoter Antonius Plagge 118017 pLX313-Firefly...

...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ATP Sensors iATPSnFR2 5-HT Sensors GRAB...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1...Schreiter 172907 pGP-AAV-syn-FLEX-Volton2-ST-WPRE Syn Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter...

...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...59724 cut S. pyogenes 25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes...pyogenes 26918244 Lu BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244...

...//www.thesgc.org/ SGC Toronto: https://www.thesgc.org/scientists/groups/toronto SGC Oxford: http://www.sgc.ox.ac.uk...without restriction. Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited...the SGC plasmid collection by All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids...

...specific neurons, often utilizing viral expression systems, to activate or deactivate these neurons in a .... When using these opsins as a tool to control neuronal activity, scientists generally attach a fluorescent... table below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search...

... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...

...Edward Boyden (Addgene viral prep # 84445-AAVrg). Electron Microscopy The ratio of empty to full (i.e., genome...representative vector preparations was quantified with electron microscopy after negative staining. Empty vector...appear darker than full vector particles. Figure 3: Electron micrograph of AAV vector preparation shows that...psPAX2 and pMD2.G packaging system developed by the Trono lab . Cell culture medium (OptiPro SFM) containing...

..., an immortalized pre-neuronal cell line that can be differentiated into neurons Coriell Institute: Patient-specific...the location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene...and cell-specific differences and correlate with neuronal maturation. Hum Mol Genet . 11, 115–124. PMID:...

...mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171...neuroscience to control electrical potentials in neurons. See our Optogenetics Plasmids and Optogenetics...Wild-type ChR2 ChR2/H134R soCoChR ChR2/other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory...

...tropism - AAV.MaCPNS1, AAV.MaCPNS2 Cell type-biased: Neurons - AAV.CAP-Mac, AAV9-X1.1 For marmosets: Broad tropism... tropism - AAV.CAP-B22 Cell type-biased: Neurons - AAV.CAP-B10 Brain vascular cells - AAV.CAP-Mac For ...: Broad tropism - AAV-PHP.eB Cell type-biased: Neurons - AAV.CAP-Mac Brain vascular cells - AAV9-X1.1,...animal Brain vascular cells - AAV9-X1.1, AAV1-X1 Neurons - AAV.CAP-B10, AAV-PHP.N Broad - AAV-PHP.AX with...

...variable 91,948 Toronto KnockOut - Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut... 67989 Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753...Knockout Mouse Superti-Furga 3rd 6 2,384 Mouse Toronto KnockOut (mTKO) CRISPR Library 159392 159393 Knockout...

... pseudotyped virus for SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the...Nemazee lab - Pseudotyped virus protocol for coronaviruses (184 KB) Addgene Blog Posts Viral Vectors 101...COVID-19 Resources and Collections COVID-19 and Coronavirus Plasmids & Resources Ginkgo Bioworks COVID-19...

...Filaments (neuronal) Nefm EGFP Anthony Brown 32909 pEGFP-mNFM Intermediate Filaments (neuronal) Nefm EGFP... proteins from the cell to the extracellular environment. Proteins are first translated at the endoplasmic...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...

...Optogenetics Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1...Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-5-PV3447 59171-AAV5...-GFP Ed Boyden AV-9-PV3446 59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40...Karl Deisseroth AV-8-PV3706 62726-AAV8 pAAV-Syn-Chronos-tdTomato Ed Boyden AV-1-35507 35507-AAV1 pAAV-Ef1a-DIO...

...includes a high efficiency intron-optimized SpCas9-coding gene, zCas9i, and an intronized Cas9 series of vectors...Cloning Chloroplast Toolbox for design of synthetic operons for chloroplast transformation and metabolic engineering...

...general repair pathways: the efficient but error-prone non-homologous end joining (NHEJ) pathway and the...to the desired edit can increase efficiency. Synchronizing cells or modulating the cell cycle can help ...exhibit almost unidirectional insertions but are more prone to off-target insertions. And in the case of both...differentiation. The system is reversible, with a companion CRISPRon to undo repression using a TET1-dCas9 fusion. ... Gelsinger, D. R., Vo, P. L. H., Klompe, S. E., Ronda, C., Wang, H. H., & Sternberg, S. H. (2024). Bacterial.... 41 (7), 968–979. PMID: 36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang...

...and additional plasmids tetR-KRAB On Aebischer & Trono 16542 pBI-MCS-EGFP Expression of your gene of interest...fos-tTA Mouse fos promoter plus part of the first intron (-764/+918) and fos 3'UTR tTA Off Mayford 38056....tTA Adenoviral; CMV promoter; see article for neuronal-specific promoter and enhancer options tTA Off...

...transgene delivery to projection neurons. Specific classes of projection neurons can be targeted by using this...Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Boyden 83898 pAAV-mDlx-ChR2...

...PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; ...pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in neurons. SpCas9 guide acceptor: The PX552 plasmid (#60958...-mediated expression of an sgRNA targeting the neuronal-specific gene NeuN. As a control they designed...

...or sort buttons to find SARS-CoV-2 and common coronvirus plasmids based on: Gene insert (e.g. spike, envelope...collection at Addgene. Addgene's COVID-19 and Coronavirus Plasmids & Resources page outlines our entire...

...Affinity Purification, Cell Ablation Monosynaptic Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1,...

... function and examine the relationship between neuronal signaling and behavior. Depending on the signaling...the opsin to either excite or inhibit the target neuron. For more detailed descriptions of chemogenetic...

...used for neurophysiology experiments, including neuronal connectivity labeling. ID Name Expression System...TEVp EF1a-driven, Cre-dependent Cre-dependent, bicistronic expression of designer pro-taCasp3 and TEVp for...

...protocols Lentiviral packaging plasmids Web Resources Trono Lab Lentivectors Toolbox Optimized shRNA design ... in a new window) . Wiznerowicz, M., Szulc, J., Trono, D. (2006). Tuning silence: conditional systems ...

...production of viruses containing transgene under Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP...pShuttle-CMV-F2A-T2A-Venus Shuttle For production of viruses with multicistronic expression + Venus tag; See plasmid 62622 for...

...pMD2.G Envelope VSV-G-expressing envelope plasmid Trono 1733 pCI-VSVG Envelope VSV-G recommended for the...expression Chen 52114 pMSCV-IRES-mCherry FP MSCV A bicistronic IRES-mCherry containing retroviral plasmid Vignali...

...Adenoviruses are commonly used as vaccines because of the strong immunogenic response they induce. Some (oncolytic...Community Resources Nolan Lab Retroviral Systems Trono Lab Lentivector Toolbox Guide to Generating Recombinant...