Skip to main content
Addgene

We narrowed to 1,029 results for: ELL

Showing: 81 - 120 of 1029 results
  1. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...experiment, target cells are treated with the pooled library to create a population of mutant cells that are then...quantities of cells and therefore, may not be suitable for use when the number of cells is limited (e....ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface...e.g. primary cells). Most CRISPR libraries require the use of lentivirus to deliver the gRNA/Cas9 to target... target cells. Therefore, you must be equipped and authorized to use lentivirus in your lab. Once you ...organism, and the library is only compatible with cells derived from that organism. All of our current pooled...Bradley 3rd 8-10 pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human...
  2. Tetracycline Inducible Expression

    Type
    Collection
    ...Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids Collection Tetracycline Off Tetracycline...expression of the transactivator proteins in mammalian cells or other species by codon optimization of their ...gene of interest from two separate vectors. Stable cell lines or transgenic animals can be made to achieve... and ensures that all transfected or transduced cells express both components in the same relative ratio...derivatives can be found in Krueger et al., 2004. Some cell culture sera may contain tetracycline or its derivatives... gene expression. rtTA-Advanced H1-2O2 Stephen Elledge 111177 LT3GEPIR Lentiviral Tet-On inducible RNAi...expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS ...
  3. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...proliferating cells. Expression may cause repetitive recombination leading to genomic instability and cell death...and control the expression of specific genes in cells or organisms. Each recombinase enzyme recognizes...expressing Cre , Flp , Dre , other recombinases , as well as useful empty backbones or reporters . Experimental... the enzyme at specific times or locations using cell-specific promoters or inducible systems, you can...promoters. Expression of both fragments in the same cell reconstitutes a functional protein, allowing recombination...expression. For example, iCre or FLPo in mammalian cells may facilitate higher rates of Cre-driven recombination...Flp-IN: A single FRT site within the genome of a host cell line serves as the target location for integration...
  4. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...vectors designed to express nucleases in different cell types. Zinc finger arrays can be transferred in-...vectors designed to express nucleases in different cell types. Zinc finger arrays created using ZFC reagents...nuclease domains: pST1374 (for expression in mammalian cells or zebrafish) pDW1775 (for expression in plants)... Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish (can be used as a substitute for pMLM335... Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish (can be used as a substitute for pMLM336... Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish). pMLM802 (for expression of a ZFN ... Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish). pMG10 (a '“2-in-1” ZFN cassette for...
  5. mTOR Pathway

    Type
    Collection
    ...Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID... (mTOR) is a key metabolic regulator controlling cell growth and proliferation. mTOR, a serine/threonine...signals to determine the nutritional state of the cell and regulates the switch from anabolic to catabolic...growth factors, including insulin. mTORC2 influences cell survival and cytoskeletal organization. Cancer Impact... promotes the conditions needed for uncontrolled cell growth and proliferation, including an abundant ...abundant supply of macromolecules and energy, as well as the presence of both pro-proliferative and anti-apoptotic...appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway Plasmids...
  6. Promega Plasmid Collection

    Type
    Collection
    ...NanoLuc fusions are useful for both intracellular and extracellular applications where you want minimal...expression systems including E. coli , mammalian cells, and cell-free systems. HiBiT Fusions HiBiT is a small...scientists and designed to streamline molecular and cellular biology experimental workflows. The collection...proteins at endogenous levels in lysates or live-cells, thus preserving physiological relevance. NanoBiT... to either LgBiT or SmBiT and expressed in live cells. When the two proteins interact, the subunits come...designed to measure molecular proximity in living cells. NanoBRET PPI assays use NanoLuc Luciferase as a...NanoBRET 618 fluorophore, as the energy acceptor. Live-cell reagents allow you to detect PPI induction and inhibition...
  7. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...adipose tissue-derived mesenchymal stem cells into pluripotent stem cells by a mutant adeno-associated viral..., 20 mM Tris at pH 8.0) Suitable for in vitro as well as in vivo delivery where the vector is diluted ...serotype also demonstrates enhanced transduction of cells in culture for ex-vivo conditioning. The AAV2(trpYF...displays enhanced transduction of hematopoietic stem cells and microglia. The AAV6(dbY-F+T-V) serotype was ...AAV-mediated transduction and targeting of retinal bipolar cells with improved mGluR6 promoters in rodents and primates...human gene therapy of glaucoma and their reversed cell entry characteristics. Gene Ther . 2020 Apr;27(3...delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of...
  8. Ras Pathway

    Type
    Collection
    ...molecular switches that transmit signals within the cell. GTPases have an active (GTP) and inactive (GDP)...prominent roles in signaling pathways regulating cell migration, survival, adhesion, growth, and differentiation...Cancer Impact Ras is ubiquitously expressed in all cells and all tissues. Ras can activate a variety of ...pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. Ras is essential...essential for regulating the growth of the cell, however when mutations occur in the Ras gene it can be... active form, constantly activating pathways for cell growth and potentially leading to cancer. Constitutively...E2F2 E2F3 E2F transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor...
  9. Luciferase Plasmid Collection

    Type
    Collection
    ...not secreted, so cells must be lysed or the substrate must be delivered intracellularly to measure luminescence...Expression of firefly luciferase from a cell-free mammalian cell lysate Marcel Bruchez 108542 pLenti-EF1a-Luciferase-IRES-Blast-WPRE...Insertion of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter...expression of luciferase in the cytoplasm of mammalian cells Peter Cockerill 212936 pGL3 Basic Vector Firefly... viral infection efficiency, to study changes in cell physiology, or as a reference level of expression...Expression of Gaussia luciferase; GFP is expressed if cells are infected with virus Christopher Buck 98580 pLX304...membrane-anchored version useful for labeling extracellular vesicles. LumiScarlet : A fusion of LumiLuc ...
  10. p53 Pathway

    Type
    Collection
    ...p53 are in promoting cell cycle arrest, apoptosis, or senescence in damaged cells. The p53 name arose ...top References Unravelling mechanisms of p53-mediated tumour suppression. Bieging KT, Mello SS, Attardi ...transcription factor and tumor suppressor activated by cellular stress. Cancer...transcription factor and tumor suppressor activated by cellular stresses like DNA damage, oxidative stress, and...or E2 Cyclin G CCNG1 CCNG2 Cyclin G1 or G2 CDC25 Cell division cycle 25C Cdk4/6 CDK4 CDK6 Cyclin-dependent...member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor Gadd45 GADD45A GADD45B GADD45G...ML, Ogryzko V, Gardner K, Giordano A, Levine AS, Kelly K. Nature. 1997 Jun 27;89(7):1175-84. PubMed PMID...
  11. Fluorescent Protein Guide

    Type
    Collection
    ...genetically engineered cellular receptors that affect signalling pathways within cells. Subcellular Localization...measure, and control molecular signals, cells, or groups of cells with either actuators or sensors. Chemogenetics...Monitor small biomolecules or other physiological intracellular processes with genetically encoded fluorescent...where your protein of interest resides by using a well-characterized fluorescent fusion protein. In Vivo...tagged with a variety of fluorescent proteins, as well as over 100 empty backbones. Fluorescent Protein...
  12. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Pan-Neurofascin (extracellular) [A12/18R] Pan-Neurofascin (extracellular) Rat Mouse IgG2a 177439...Anti-Kv1.4 K+ channel (extracellular) [L71/5R] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 177489...Mouse IgG2a 177564 Anti-ADAM22 (extracellular) [N57/2R] ADAM22 (extracellular) Mouse Mouse IgG2a 177565 Anti-GluN2B...Anti-Kv1.4 K+ channel (extracellular) [L71/22] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 190292...-Neurofascin (extracellular) scFv [A12/18] A12/18 scFv 2t Pan-Neurofascin (extracellular) Rat Mouse 190486...Kv1.4 K+ channel (extracellular) scFv [L71/5] L71/5 scFv Kv1.4 K+ channel (extracellular) Rat Mouse 190518... Mouse 190537 LRP4 (extracellular) scFv [N207/27] N207/27 scFv LRP4 (extracellular) Mouse Mouse 190538...
  13. Genetic Code Expansion

    Type
    Collection
    ...expanding the genetic code in bacteria and mammalian cells....codons, and tRNA synthetases are introduced into the cell on plasmids and the new amino acid is introduced...Once these plasmids have been introduced in the cells, the non-canonical amino acid can be incorporated...match the growth medium, ncAA concentration, and the cell lines used previously. Remember that the orthogonal... – GFP for E. coli or mCherry-GFP for mammalian cells. You should also express the protein with and without...tRNA synthetase for use in E.coli and Mammalian Cells. Many of the plasmids also contain one or more copies...coli azi-donorleucine (Anl) Bacterial ATG David Tirrell 62598 pKPY514 phenylalanyl-tRNA synthetase subunit...
  14. AAV Molecular Tools

    Type
    Collection
    ...Scanziani Tools for Cell Ablation These AAV encode tools that can be used for cell ablation. ID Name Expression...toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven...designer pro-taCasp3 and TEVp for studying cell ablation. 5 Shah , Wells Genome Engineering Tools These AAV encode...Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators and Inducible...
  15. iPSC Neurodegenerative Disease Initiative Plasmid Collection

    Type
    Collection
    ...nucleotide variant lines in an isogenic cellular background. All cell lines and phenotypic datasets that result...CRISPR Guide CRISPR Protein Tagging Plasmids for Stem Cell Research Neurodegeneration Research Collection The...Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants or ...or to differentiate human iPSCs into other cell types, as noted in the purpose field: ID Plasmid Description...neurodegenerative diseases with genomic engineering: A new stem cell initiative from the NIH. Neuron . 2021 Apr 7;109...
  16. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...-repetitive genomic loci, as well as chromosome painting in living cells. Visualizing a specific genomic...compatible with fluorescence microscopy in living cells. Alternatively, gRNAs can be fused to protein-interacting... multiple genomic loci, and compatible with live cell imaging. Compared to techniques like fluorescence... for detecting the chromatin dynamics in living cells. The fluorescent CRISPR system has been used for...repetitive loci can be efficiently visualized in living cells using a single gRNA that has multiple targeted sequences...
  17. Institute for Protein Innovation

    Type
    Collection
    ... of cell surface and secreted proteins (glypicans and integrins) and common epitope tags, as well as antibody...unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...mission, IPI is providing access to high-quality, well-characterized antibodies in an open science model...highly conserved proteoglycans crucial for regulating cell signaling during development. The IPI collection...antibodies that target epitope tags and other common cellular proteins. ID Recombinant Antibody Description ...
  18. Optogenetics Plasmid Collection

    Type
    Collection
    ...kinetic properties as well as improve the expression and membrane targeting in host cells. Other microbial ... optical switch tools to measure and manipulate cells and their biomolecular processes. Plasmid...to blue light and allows cations to flow into the cell. Variants of channelrhodopsin have been engineered...actively move cations or anions into or out of the cell. When using these opsins as a tool to control neuronal...plasmids that use light to control a protein or cellular activity. For example, search "Cdc42", "transcription...
  19. CRISPR References and Information

    Type
    Collection
    ...interest and correspond to edited and non-edited cell populations. For more information, see the Hsiau...nucleases (e.g. base editing). Developed by the Luca Pinello Lab (Link opens in a new window) . For more details...), clone (primer design), and evaluate gRNAs, as well as predict off-targets, for CRISPR in 180+ genomes...window) A sgRNA design tool for genome editing, as well as gene regulation (repression and activation). ...identify novel gRNA target sites in a single gene, as well as a target site common to a set of similar sequences...138 KB Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook...Bauer Protocol for Genomic Deletions in Mammalian Cell Lines pSpCas9(BB) (pX330) Protocol at Addgene Parrott...
  20. Retrovirus Plasmids

    Type
    Collection
    ...reverse transcriptase and integrase. Once in a target cell, the virus uses the reverse transcriptase in tow...γ-retroviruses are that they can only transduce dividing cells (this is because they are only able to enter the...of Large T antigen for creation of immortalized cells (see Weinberg Lab page for resistance variants) ...Expression of hTERT for creation of immortalized cells; additional plasmids include Puro resistance and...inducible expression of GFP T2A Cre fusion in mammalian cells Foijer 47916 pRXTN CMV/MSV pRXTN is a modified version...MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you have suggestions for other...
  21. Antibody Plasmid Collection

    Type
    Collection
    ...expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits include consistency between...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More Cloning... research purposes include animals or hybridoma cells, but are difficult to generate due to expense and...monoclonal antibodies (R-mAbs) expressed in mammalian cells. Monoclonal antibodies are derived from an individual...transiently transfected into mammalian tissue culture cells, the R-mAbs are secreted into the culture media ...
  22. Worm Expression Resources

    Type
    Collection
    ...maintenance. Worms are particularly well suited for studies in cell biology, development, and aging. Scientists.... elegans hermaphrodite consists of 959 somatic cells, which makes them attractive for imaging and fluorescence...microscopy experiments. The C. elegans genome is well studied and hundreds of reporters have been developed...researchers to express desired constructs in precise cell types and/or developmental timeframes. Here we highlight...detection of genome-editing events. Developed in Craig Mello's lab and described in A Co-CRISPR Strategy for Efficient...
  23. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ... time and are potentially heritable in dividing cells. ID Plasmid Gene/Insert Selectable Marker PI Publication...DNA. Type VI enzymes that function in mammalian cells can be used to attentuate RNA levels. In mammalian...genomic loci using fluorescent microscopy in living cells. Design your gRNA sequence to direct the dCas9-FP...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...
  24. Control AAV Preps

    Type
    Collection
    ...pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx...83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Fishell 99130 pAAV-mDlx-NLS-mRuby2...Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent...
  25. Lentivirus Plasmids

    Type
    Collection
    ...Lentivirus can transduce both dividing and non-dividing cells without a significant immune response. These viruses... in the viral particle) is delivered to a target cell upon infection. When lentivirus is used for research...the researcher wants delivered to specific target cells. This genome is encoded by plasmids called "transfer...encoded by the transfer plasmid is toxic to mammalian cells, it can be difficult to efficiently produce viral...of viral transduction. Also see plasmid 46948 . Elledge 44011 pInducer10-mir-RUP-PheS 3rd Lentiviral shRNA...transduction. See article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression...
  26. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1...Fluorescent Protein Resources: FRET Biosensors Subcellular localization Michael Davidson Collection Blog...More References below Jump to: Blue/UV Cyan Green Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift...Cloning Vector - Mammalian Expression Jump to Top Yellow Protein Excitation (nm) Emission (nm) Brightness...2011, pp. 313–327 Scholarpedia : Entry by Robert Campbell Spectra Database : Graphing site hosted at the...University of Arizona Shaner et al. : Journal of Cell Science, Vol. 120, December 2007, pp. 4247-4260 ...
  27. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...function in zebrafish, plants, and human cells ( Maeder et al., Mol Cell 2008 , Foley & Yeh et al., PLoS ONE... Townsend et al., Nature 2009 , Zou et al., Cell Stem Cell 2009 ). Resources A detailed protocol for practicing...ZFNs that function in zebrafish, plants, and human cells Kits...
  28. Antibody Production

    Type
    Collection
    ...mammalian expression vectors, human embryonic kidney cells are transfected with the plasmid(s) encoding the.... This buffer is not compatible for use in live cells and will interfere with conjugation. For applications...antigen is first transiently expressed in mammalian cells. To learn which specific QC experiments were performed...email [email protected] . Immunocytochemistry (ICC) Cells are fixed and labeled with the antibody and a species-specific...Western Blotting (WB) Proteins are extracted from cells, separated by SDS-PAGE, transferred to a membrane...
  29. Chemogenetics AAV Preps

    Type
    Collection
    ...-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D... chemically induce neuronal activity in specific cell types. See our Chemogenetics Plasmids and Chemogenetics...
  30. Microbiology Resources

    Type
    Collection
    ... Ralstonia solanacearum Rickettsia sp. Salmonella sp. Shigella sp. Staphylococcus sp. Streptococcus sp...Species Anabaena sp. Bacillus sp. Burkholderia sp. Bordetella pertussis Campylobacter sp. Chlamydia sp. Clostridium...reading frames for vaccinia virus - Bennink and Yewdell Labs Yarrowia lipolytica Golden Gate tool kit :...applications like recombinant protein purification and cell-free circuit design in E. coli - Freemont Lab MoClo-YTK...
  31. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...
  32. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ...be used for screening transcription factors for cellular programming or cancer drug resistance....Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...transcription factors for applications such as cellular programming or cancer drug resistance. Protocols...Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell 2023 Jan 5; 186(1):209-229. PubMed (Link opens in...
  33. Cancer Research Plasmids and Resources

    Type
    Collection
    ...important to normal cell signaling and physiology, and, when dysregulated, can enable cancer cell survival. Although...that is essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human...somatic variants found in lung adenocarcinoma as well as variants found across cancer types as part of...
  34. Synthetic Biology - Overview

    Type
    Collection
    ...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff... Keasling Taek Soon Lee Joshua Leonard Han Lim Wendell Lim Timothy Lu Michel Maharbiz Thorsten Mascher...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter...
  35. Adenovirus Plasmids

    Type
    Collection
    ...target a broad range of dividing and non-dividing cell types with almost 100% efficiency. Unlike lentiviruses...adenoviruses include transient transgene expression, as well as the substantial immune response induced by the...recombination of adenovirus plasmids in either mammalian cells or microorganisms, including bacteria and yeast....can then be transfected into mammalian packaging cell lines to generate adenovirus particles. Read our...
  36. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...e.g., pHelper) and specific packaging cell lines (e.g., HEK293 cells) during AAV production. Read our AAV...AAV can transduce both dividing and non-dividing cells with a low immune response and low toxicity. Although...in-stock preps that are ready to ship right away, as well as our Packaged on Request service to give you more...
  37. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...abundant forms of posttranslational modifications in cells and research into its many roles in protein function...interactions can be discovered by fluorescence-activated cell sorting (FACS). The mode #2 phosphosite library ... Production of Recombinant Phosphoproteins Using Cell-Free Protein Synthesis. Oza JP, Aerni HR, Pirman...Ordureau A, Paulo JA, Rinehart J, Harper JW. Molecular Cell . 2015. Sep 9. pii: S1097-2765(15)00662-0. doi: ...
  38. Validated gRNA Sequences

    Type
    Collection
    ... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens... compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut ...
  39. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634 pAAV-S5E2-ChR2-...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength fluorescent protein Blue-wavelength ...
  40. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ...Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables Empty Backbones Plasmid Description...Description Industry Greens Plasmid Description Industry Yellows Plasmid Description Industry Photoactivatables ...
Showing: 81 - 120 of 1029 results