We narrowed to 154 results for: TOR;
-
TypeCollection...Feng Zhang - Multiplexed Overexpression of Regulatory Factors (MORF) Collection You may also like... Feng...transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two control vectors. The...the Zhang lab’s comprehensive human transcription factor collection, available at Addgene. The collection...screening transcription factors for cellular programming or cancer drug resistance. Depositor... Depositor Collections MORF...can be purchased at Addgene. Each transcription factor isoform has a unique 24 bp barcode that simplifies...simplifies identification of the transcription factor isoform in pooled screens. This collection and library...
-
mTOR Pathway
TypeCollection...complexes, mTORC1 and mTORC2. Each complex contains a unique subunit: raptor for mTORC1, and rictor for ...for mTORC2. Background mTORC1 & mTORC2 The better-characterized mTORC1 responds to various signals, including...Ras-related GTP binding Raptor Also known as RPTOR; Regulatory associated protein of MTOR, complex 1 Rheb Ras...plasmids for the mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates with ...apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation. mTOR, a serine...inactivating mutations in negative regulators of mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions...kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase and tensin homolog Rictor RPTOR independent... -
Depositor Collections
TypeCollection... Sigma (σ) Factor Plasmids Terminator Plasmids Viral Vectors pLEG/pREG Modular Viral Vector System - Dankort... Plasmid Collections Depositor Plasmid Collections Depositor Collections ...Addgene's repository contains 162,248 plasmids, which includes plasmid collections from depositors. To help...Collection Screening Multiplexed Overexpression of Regulatory Factors (MORF) Collection Synthetic Biology Voigt... Dankort Gene Vector Core Viral Vectors - Oka...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...biology, and viral vector plasmids. Plasmid... -
The SGC Toronto Collection
TypeCollection...Structural Genomics Consortium Plasmids - Toronto Plasmid Gene/Insert Vector Type Backbone Mutations Tags Industry... from the Structural Genomics Consortium (SGC) Toronto collection Plasmid...Genomics Consortium Plasmids Browse SGC Toronto collection Structural Genomics Consortium Plasmids Structural... -
TALEN Expression Vectors
TypeCollection...Mammalian expression vectors for TAL effector repeat arrays assembled using the REAL, REAL-Fast or FLASH...TALengineering Reagents TALEN Expression Vectors TALEN Expression Vectors for REAL, REAL-Fast and FLASH You ...This page lists plasmid vectors into which DNA fragments encoding TAL effector repeat arrays (assembled...website . All three of these methods yield TAL effector repeat arrays with identical DNA and amino acid...the final products are the same). All expression vectors listed below have the CMV promoter for mammalian...transcription of RNA. TALENs expressed from these vectors also have a FLAG epitope tag and nuclear localization...signal at their amino-terminus. The expression vectors listed below can be purchased together with the... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Collections Gene Vector Core Viral Vectors Gene Vector Core Viral Vectors Lentiviral Transfer Vectors Adenoviral... transfer vectors and generating new viral vectors. Download the Lentivirus Transfer Vector Production...lentiviral and adenoviral vectors read our Lentiviral Vector Guide and Adenoviral Vector Guide Find more plasmids...Lentiviral Vectors deposited by Kazuhiro Oka from the Baylor College of Medicine Gene Vector Core Depositor...Adenoviral Transfer Vectors Resources Kazuhiro Oka and the Gene Vector Core (Link opens in a new window) of ...lentiviral and adenoviral transfer vectors with Addgene. Lentiviral Transfer Vectors Within this set of lentiviral...PGK promoter Adenoviral Transfer Vectors The adenoviral transfer vectors contained within this set are derived... -
Viral Vector Guides and Plasmids
TypeCollection...Guides Viral Vectors Viral Vector Guides and Plasmids Selecting a Viral Vector Type Introduction to Viral...Viral Vectors Resources Viral vectors are popular tools for delivering genetic information to cells. These...and Plasmids Lentiviral Vector Guide | Lentiviral Plasmids Lentiviral vectors are versatile tools because...the host genome. AAV Vector Guide | AAV Plasmids Adeno-associated viral (AAV) vectors are commonly used ... Gamma-retroviral Vector Guide | Gamma-retroviral Plasmids Gamma-retroviral vectors, often referred to...Retroviral vectors are popular for making stable cell lines or clinical use. Adenoviral Vector Guide | Adenoviral...applications as vaccines. Selecting a Viral Vector Type Each viral vector type exhibits different properties and... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...expression vectors for insertion of custom gRNA target sequences. CRISPR... CRISPR Empty gRNA Vectors CRISPR Plasmids...Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ... -
CRISPR History and Development for Genome Engineering
TypeCollection... CRISPR CRISPR History CRISPR History and Development for Genome Engineering ...Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type II ...technologies that do not rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating...The first base editors converted cytidine to thymidine; newly engineering base editors convert adenosine...various CRISPR-associated (Cas) genes to not only store a record of invading phages but also to destroy ...two large classes based on the structure of the effector complex that cleaves the genomic DNA. Type II ...adenosine to guanosine. RNA editors : Cas13 fused to the ADAR2 deaminase convert adenosine to inosine on RNA... -
Penn Vector Core Partnership with Addgene
TypeCollection...Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector Core...AAV vectors to the academic research community. The Penn Vector Core produced viral-based vectors for ...Addgene's viral vectors See Addgene's Current AAV inventory , which includes all viral vectors transferred...Transfer The University of Pennsylvania Vector Core (Penn Vector Core) and Addgene previously partnered...a viral vector with the Penn catalog ID: Based on low demand, production of some viral vectors have been...See the list of discontinued viral vectors . The following vectors are now available for distribution ...Optogenetics Baljit Khakh Discontinued Penn Vector Core Viral Vectors (Plasmids still available, other serotypes... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...Consortium: Nuclease Expression Vectors This page lists plasmid vectors designed to express nucleases in...transferred in-frame to any of these vectors using unique cloning sites. Vectors encoding wild-type FokI nuclease...This page lists plasmid vectors designed to express nucleases in different cell types. Zinc finger arrays...in-frame to these vectors. Plasmid... Plasmid Collections Zinc Finger Consortium Nuclease Expression Vectors Zinc Finger... zebrafish) pDW1775 (for expression in plants) Vectors encoding heterodimeric FokI nuclease domains: pMLM290... -
Immunology Research Plasmids and Resources
TypeCollection...receptor C MGC129539, NR1F3, RORG, RZR-GAMMA, RZRG, TOR RXFP1 relaxin/insulin-like family peptide receptor...IREL RFX5 regulatory factor X, 5 (influences HLA class II expression) - RFXANK regulatory factor X-associated...cytokine receptor-like factor 1 CISS, CISS1, CLF, CLF-1, NR6 CRLF2 cytokine receptor-like factor 2 CRL2,...cytokine receptor-like factor 3 CREME9, CYTOR4, FRWS, MGC20661 CSF1 colony stimulating factor 1 (macrophage...growth factor receptor 3 ACH, CD333, CEK2, HSFGFR3EX, JTK4 FGFR4 fibroblast growth factor receptor 4 CD334...plasminogen activator, urokinase ATF, UPA, URK, u-PA PLAUR plasminogen activator, urokinase receptor CD87, ...CNTF ciliary neurotrophic factor HCNTF CNTFR ciliary neurotrophic factor receptor MGC1774 CORT cortistatin... -
Fluorescent Protein Guide: Biosensors
TypeCollection...and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring norepinephrine in vivo...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...encoded calcium indicators. J Biol Chem. 2019 Mar 15;294(11):3934-3946. Katalin Torok Calcium Red Calcium...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...compatible Y2H vector - BD pRPR1_gRNA_handle_RPR1t - gRNA expression empty vector pFA6a vectors - Epitope ...pFastBac Dual LIC - Vectors from the Gradia lab pFB-LIC-Bse - Insect expression vector from Gileadi lab ...expression vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF...Gateway destination vector for bacterial expression; His,GST tag pE2c - Modified pENTR vector for C-terminal...-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast surface display vector with a C-terminal Myc...His-tagged versions of pFastBac LIC vectors and pFastBac Dual LIC vectors for insect expression Fluorescent...35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging vectors in budding yeast pHT101-mCherry... -
Tetracycline Inducible Expression
TypeCollection...popular empty backbones, expression vectors for transactivators, and vectors for other applications, or search...transcription factors to further minimize background expression. Improved expression of the transactivator proteins...should also choose between: Dual vector system: express the transactivator and the tet-controlled gene of...both the transactivator and the tet-controlled gene of interest from one plasmid. A single vector approach...generations of transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter...Request service available for many transactivator or tet-inducible vectors. Tetracycline-inducible Backbones...Lentiviral Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an... -
Brain Initiative Collection
TypeCollection... the E2 regulatory element Jordane Dimidschstein 135630-AAV9 pAAV-S5E2-dTom-nlsdTom AAV vector to drive...the E2 regulatory element Jordane Dimidschstein 135630-PHPeB pAAV-S5E2-dTom-nlsdTom AAV vector to drive...of the E2 regulatory element Jordane Dimidschstein 135631-AAV1 pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135631-AAV9 pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135631-PHPeB pAAV-S5E2-GFP-fGFP AAV vector to drive ...of the E2 regulatory element Jordane Dimidschstein 135632-AAV1 pAAV-S5E2-GCaMP6f AAV vector to drive the...of the E2 regulatory element Jordane Dimidschstein 135632-AAV9 pAAV-S5E2-GCaMP6f AAV vector to drive the... -
Trimmer Lab NeuroMab Collection
TypeCollection...GFP Aequorea victoria Mouse IgG2a 188167 Anti-IP3 receptor, type 1 [L24/21R] IP3 receptor, type 1 Rat ...in a new window) together with the laboratory of NeuroMab Director, Dr. James Trimmer, have produced numerous...Anti-GluA1/GluR1 glutamate receptor [N355/1R] GluA1/GluR1 glutamate receptor Rat Mouse IgG2a 114484 Anti-Stonin... IgG2a 114488 Anti-Dopamine D3 receptor [N331/19R] Dopamine D3 receptor Human Mouse IgG2a 114490 Anti-...Anti-GluN2B/NR2B glutamate receptor [N59/36.1R] GluN2B/NR2B glutamate receptor Rat Mouse IgG2a 114509 Anti-Pan-FHF-A...Anti-GluK5/Grik5/KA2 kainate receptor [N279B/27R] GluK5/Grik5/KA2 kainate receptor Rat Mouse IgG2a 149452 Anti-Kirrel3... IgG2a 177509 Anti-Dopamine D2 receptor [N186/29R] Dopamine D2 receptor Rat Mouse IgG2a 177510 Anti-SAP102... -
Ras Pathway
TypeCollection...INSR Insulin receptor INSRR Insulin receptor-related receptor IRS IRS1 IRS2 Insulin receptor substrate JUN...transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1...proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated protein, LST8 homolog MTOR Mechanistic target...Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador family... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...Eukaryotic translation initiation factor 4E binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1... -
Caltech Systemic Capsids
TypeCollection...eYFP E2 regulatory element Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service...CLOVER Center’s repository of published capsid use (Link opens in a new window) . Viral Vectors 101: Systemic...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...mCherry Syn Activator, Cre-dependent DREADD Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Syn Inhibitor, Cre-dependent...Roth 135635 pAAV-S5E2-Gq-P2A-dTomato E2 regulatory element Activator DREADD Dimidschstein Biosensors 104491...EF1a Activator, Cre-dependent ChR2 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP CAG Activator, Cre-... -
Plasmids for Stem Cell Research
TypeCollection...generation vectors for transcription factor mediated differentiation of iPSCs into cortical and motor neurons...lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral vector for "hit...lentiviral vectors for human iPSC generation OCT4 and SOX2 Work as Transcriptional Activators in Reprogramming...Fibroblasts Hematopoietic Progenitor Cells Lentiviral Human Cooperative Transcription Factor Induction Mediates...Fibroblasts Oligodendrocyte Progenitor Cells Lentiviral Mouse Transcription factor-mediated reprogramming ...Rapid Ngn2-induction of excitatory neurons from hiPSC-derived neural progenitor cells. Methods. 2015 Nov...iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation... -
Retrograde AAV viral preps
TypeCollection...Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular Tools... Viral Vector Packaging Service AAV Retrograde AAV Viral Vector Packaging Service: Retrograde...the Alla Karpova and David Schaffer laboratories. These viral vector preparations were produced with the...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...CamKII Activator Optogenetics Deisseroth 55639 pAAV-Ef1a-fDIO hChR2(H134R)-EYFP EF1a Activator Optogenetics...(H134R)-GFP Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Boyden...mCherry-Fishell-3 mDIx Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics... -
TALEN Plasmids and Kits
TypeCollection...contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based ...engineering. Fusions of transcription activator-like (TAL) effectors of plant pathogenic Xanthomonas spp...UTRs are included in the vector to enhance expression of the message. Both vectors utilize homodimeric FokI...the Golden Gate TALEN and TAL Effector Kit. These modified pFUS vectors can reduce the number of module...Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis vectors containing... These new destination vectors can be used to create TALE-transcription factors and are used at the final... of polymorphic amino acid repeats in the TAL effectors. View Addgene's TALEN Guide. These collections... -
CRISPR Guide
TypeCollection...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in... -
Plan Your Experiment
TypeCollection...about viral vectors and their production, see our viral vector guides . Lentiviral vectors Lentiviral ...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...base editors exert their functions within a limited window from the PAM sequence, and base editor variants...CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select Your Expression ... CRISPR plasmids . Delivery Using Viral Vectors Viral vectors are a great option, as they offer high expression... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...full sequencing of the final viral vector preparation. These viral vector preparations were produced with...Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model...of Primary Human Hematopoietic Stem/Progenitor Cells by AAV6 Vectors: Strategies for Overcoming Donor-Variation...quality AAV preps from select plasmids in the repository. Browse the University of Florida serotype testing... Viral Vector Packaging Service AAV University of Florida Serotype...Serotype Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype ... -
Viral Production
TypeCollection... with viral vector manufacturing facilities, such as the University of Pennsylvania Vector Core. Transfections...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Empty vector particles can be identified after negative staining and appear darker than full vector particles...Electron micrograph of AAV vector preparation shows that the vast majority of the vectors consist of full particles... Viral Vector Packaging Service Viral Production Viral Production...vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by...to determine which facility produced your viral vector lot. At Addgene, AAV particles are titered by droplet... -
Chemogenetics Plasmids
TypeCollection...cells expressing these engineered receptors. Chemogenetic receptors are popular in neuroscience, where...pathway the engineered receptor is coupled to and the specific cell type where the receptor is expressed, these...contains two main classes of chemogenetic receptors: Designer Receptors Exclusively Activated by Designer Drugs...Selective Actuator Modules (PSAMs). DREADDs are the most widely used chemogenetic receptors and are G-...Gi) and KORD are inhibitory. PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains ...chemogenetic resources available at Addgene. See our inventory of chemogenetic constructs, including DREADD constructs...Service: Chemogenetics AAV Blog: Chemogenetics Viral Vectors 101 Blog: Chemogenetics vs. Optogenetics Chemogenetics... -
Zhang Lab CRISPR Page
TypeCollection... in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9...Expresses dCAS9-VP64 activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with...lentiviral vector encoding dCAS9-VP64 with 2A Blast resistance marker 61426 : lentiviral vector encoding...Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, ...61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors for cancer modeling...SpCas9 or SpCas9n, and the single guide RNA. The vector can be digested using BbsI, and a pair of annealed...indicated below) can be cloned scarlessly into the vector before the sgRNA scaffold. The oligos are designed... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...technologies. Penn Vector Core AAV Vectors Many AAV vectors from the Penn Vector Core have been transferred to Addgene... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...and we’ll make the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information...about viral vector production at Addgene, ordering information, and more. Additional Viral Vector Resources...when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation...biosafety of viral vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from...aspects of viral vectors, including troubleshooting advice and explanations of viral vector technologies.... -
Bacterial Expression Systems
TypeCollection...donor) mRuby2 (acceptor) FRET Michael Davidson 18856 pGWF1 ECFP (donor) Venus (acceptor) FRET Wolf Frommer...donor) Citrine (acceptor) FRET Wolf Frommer 65617 pFLIP42 mCerulean (donor) Citrine (acceptor) FRET Wolf Frommer...CRISPR Guide Bacteria are commonly used to create, store, and replicate plasmids of all types, but beyond...strains such as E. coli BL21(DE3) are used as biofactories to express plasmids and produce proteins in ... TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase, thrombin Signal peptides for ...expression in E. coli , Bacillus subtilis , and Pichia pastoris . The EcoFlex MoClo Toolkit (Addgene #1000000080...express your protein of interest fused to FPs and monitor their localization in live cells. ID Plasmid Tags... -
TALEN Guide
TypeCollection...never happen. Yet with transcription activator-like (TAL) effectors, scientists in several biological disciplines... and help can be found at TALeffector Resources Center (www.taleffectors.com) . Whether you work in a ...between two distinct ZF target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ...published the nucleotide recognition code of the TAL effectors, which were isolated from the plant bacterial ...that determines which single nucleotide the TAL effector will recognize: ( Figure 1B ) HD targets cytosine... in your average genome are every 500 bp. TAL effectors have some restrictions (for example, the target...determining the importance of context for each TAL effector within an array, but early studies suggest the... -
Luciferase Plasmid Collection
TypeCollection...cells Peter Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription...reporting on GPCR activity. AIMTOR : BRET biosensor for live imaging of mTOR signaling. Do you have suggestions...made luciferase a popular tool for scientists. Regulatory elements such as promoters, enhancers and untranslated...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Scott Lowe 21375 pHIV-Luciferase Firefly Lentiviral vector for insertion of your gene of interest upstream...and renilla_polyA Firefly, Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream...212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating regions controlling transcription... -
p53 Pathway
TypeCollection... Tumor necrosis factor receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell ... PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP...p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor 1A p48 Damage-specific DNA...plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor activated by cellular stress...Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...List References Background p53 is a transcription factor and tumor suppressor activated by cellular stresses..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity... -
Validated gRNA Sequences
TypeCollection...EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria GAAGTTCGAGGGCGACACCC... EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT... EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC...EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG... EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria GGGCGAGGAGCTGTTCACCG... EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA... GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA... -
Neurodegeneration Research Collection
TypeCollection...upper and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to...AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell ...tet-inducible expression of transcription factors for sensory, motor, and cortical neuron differentiation....CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies Fluorescent Proteins Other Resources...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases...portion of cases can be attributed to known genetic factors such as defects in LRRK2, SNCA, PARK7, or PINK1... gene variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE... -
Plant Plasmids and Resources
TypeCollection...assembling plant transformation vectors - Daniel Voytas. Transcription Factors The following collections can...plants: Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant...microRNA and siRNA vectors in Arabidopsis - James Carrington. JoinTRV , an improved vector system based on...Blog: Plant Biology CRISPR Cloning Transcription Factors RNAi Empty Backbones Fluorescent Proteins Other...Other Resources Background Addgene’s repository contains many plasmid tools that were specifically designed...plant species (e.g. maize and Arabidopsis) and vectors for easy assembly of one or more gRNA expression...for Plants includes CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters for expression in... -
Rett Syndrome
TypeCollection...Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor (NCoR/...Cell Line Repositories (Link opens in a new window) Coriell Institute - cell line repository, including...in a new window) MMRRC Repository - NIH-supported mouse and cell line repository (Link opens in a new window...largest biorepositories (Link opens in a new window) ATCC - the world's largest cell line repository Tissue... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene disruptions... -
AAV Packaged on Request
TypeCollection...Resources Viral Vector Production Learn about how we produce high-quality viral vector preps at Addgene...Request service with all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification... Viral Vector Packaging Service Packaged on Request AAV Packaged...Additional Resources Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively...protection levels. We offer 1,001 in-stock viral vector preps, delivering high quality and ready availability...availability at affordable prices. While our repository serves the needs of many researchers, scientists sometimes... the steps to produce, purify, and titer viral vectors. Overview Our new Packaged on Request service is... -
Lentiviral Prep Service
TypeCollection...more details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled...dCas9) can be fused to a transactivator and used as a transcriptional activator . ID Name Insert Antibiotic...Ready-to-use lentivirus available from Addgene's viral vector packaging service. Browse constructs currently ... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific... -
CRISPR Plasmids - Tagging
TypeCollection...targeting vector assembly, and the remaining 5 plasmids include Cre and FLP expression vectors, a general...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...Cas plasmid-system consists of two components: A vector containing Cas9 and a validated gRNA, based on ...tagging system were tested by tagging transcription factors with FLAG in human cell lines. To repeat the tagging...the isolation of native protein complexes. This vector serves as a backbone to clone the left and right...Alternatively, cDNAs can be cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus...gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_...