We narrowed to 11,659 results for: nar
-
Plasmid#185763PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, AIDMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-P2-SpCas9
Plasmid#232354PurposeThe plasmid pBBR1-P2-SpCas9 employs pBBR1MCS-2 as the vector, with Cas9 protein derived from S. pyogenes and the stationary phase promoter P2 sourced from S. marcescens HBQA7.DepositorInsertsCas9
sacB
UseCRISPRPromoterpromoter P2 from S. marcescens HBQA7Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-tTA
Plasmid#127091PurposeAn AAV genome with Cre-dependent expression of tTA from the CAG promoterDepositorInserttTA
UseAAVExpressionMammalianMutation*(see below)PromoterCAGAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4276 hproTGFb1 in pcDNA backbone
Plasmid#244183PurposeConstitutive expression of human pro-TGF-beta1 (with its signal sequence)DepositorInsertpro-TGF-beta1 (TGFB1 Synthetic, Human)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV/D374Y-hPCSK9
Plasmid#58379PurposeExpresses GoF mutant human PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (PCSK9 Human)
UseAAVExpressionMammalianMutationD374YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRNA7
Plasmid#62276Purposemammalian expression of human Alpha7 (CHRNA7)DepositorAvailable SinceMay 21, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCEP4-myc-EphB6
Plasmid#200984PurposeMammalian expression plasmid for myc-tagged EphB6DepositorInsertEphB6 (EPHB6 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB4-Fc
Plasmid#200986PurposeMammalian expression plasmid for soluble EphB4 fused to IgG1 FcDepositorInsertEphB4 (EPHB4 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB4PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB4
Plasmid#200983PurposeMammalian expression plasmid for myc-tagged EphB4DepositorInsertEphB4 (EPHB4 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4300 hIL10 in pcDNA backbone
Plasmid#244185PurposeConstitutive expression of human IL-10 (with its signal sequence)DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pAmCyan1-C1-ADCY6
Plasmid#113905PurposeN-terminal Cyan Fluorescent tag in Adenylate Cyclase 6DepositorAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFG005_Spike_Inducible_3xFlag
Plasmid#191578PurposeInducible expression of SARS-CoV-2 Spike protein with C-terminal 3x FLAG tag under TRE3G promoter and cloned into a 2nd generation lentiviral transfer plasmid (modified pLVX with Hygro resistance).DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
UseLentiviralTags3x FLAGExpressionMammalianPromoterTRE3GAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC4-RhE-FRB-Fis1
Plasmid#68056Purposeexpress Fis1 tail-anchored FRB for heterodimerization with FKBP in mammalian cellsDepositorAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
Zed_vector_tol2_-2.1prox1a_1:EGFP_XCA:DsRed2
Plasmid#218205PurposeZebrafish -2.1prox1a enhancer reporter in the lymphatic valve from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a
UseZebrafish expressionAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pFBD-Akt13C(S473D)
Plasmid#86577PurposeExpresses cleavable human full-length Akt1(S473D) phosphomimeticDepositorInsertAkt1 (AKT1 Human)
Tags10xHisExpressionInsectMutation3C cleavage site inserted at pos. 130; S473D phos…Available SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SUMO1
Plasmid#185637Purposeexpression of GST-tagged SUMO1 in bacterial cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
L2096-GPA-BRET-Biosensor-Retrovirus-TD146
Plasmid#222878PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with BRET (split NanoLuciferase reconstitution [11S/114 fragment]). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA-NanoLuc114-CyOFP1-T2A-FKBP-GPA-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231365PurposeminBG-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231366PurposePle155-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Zed_vector_tol2_-2.1prox1a_1:EGFP_XCA:DsRed2
Plasmid#218207PurposeZebrafish -2.1prox1a_1 (mouse conserved) enhancer reporter in the lymphatic valve from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a_1
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-FGFR4
Plasmid#60531PurposeEntry vector for human FGFR4DepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR4 CDS A. thaliana PHOT1
Plasmid#209187PurposepENTR4 plasmid with CDS of Arabidopsis thaliana PHOTOTROPIN 1 (PHOT1, AT3G45780.1) without stop codon for C-terminal epitope tagsDepositorAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
PH Akt-Venus
Plasmid#85223PurposeVenus tagged PH domain of Akt for use as a PIP3 sensorDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231364PurposePle155-driven mRuby2, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T373
Plasmid#58912Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T373 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T373 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S612
Plasmid#58914Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S612 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S612 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTiam1-mcherry-sspB in pcDNA3.1
Plasmid#85221PurposeRole of Rac selective GEF domain from Tiam1 in immune cell migrationDepositorAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S608
Plasmid#58913Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S608 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S608 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJM671 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 in TUPV3
Plasmid#161573PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCMV HA hRB delta CDK + S780
Plasmid#58915Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S780 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S780 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-InPAkt
Plasmid#181915PurposeIndicator of Phosphoinositides using Akt; targeted to the plasma membrane.DepositorInsertpm-InPAkt
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationContains the following mutations with respect to …PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S811
Plasmid#58919Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S811 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S811 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJM612 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 in TUPV3
Plasmid#161571PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only