We narrowed to 10,670 results for: nar
-
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiTagsExpressionMutationPromoter2x35SAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-N (LEU2)
Plasmid#177798PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-N (TRP1)
Plasmid#177797PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-WT LMNA-GFP minigene
Plasmid#128230PurposeLamin A splicing reporterDepositorInsertlamin A (LMNA Human)
UseTagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLI
Plasmid#131228PurposeExpression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cellsDepositorInsertDNA polymerase iota (POLI Human)
UseTagsFLAGExpressionMammalianMutationCoding sequence has been codon optimised for expr…PromoterCMV enhancer + CMV promoterAvailable sinceDec. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MultiMate 5 colors
Plasmid#206266PurposeExpression of 5 fluorescently labelled proteins in mammalian cells. Can be used as a CRE-donor (MultiBac system)DepositorInsertH2B (H. Sapiens), Actin and Tubulin (B. taurus), mito mCherry (Synthetic), CyOFP1 (E. quadricolor)
UseRecombinant baculovirus production, cre acceptor…TagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)ExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPExpressionMutationDoes not contain start codon to avoid random inte…PromoterAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
UseTagsGST tagExpressionBacterialMutationdeleted amino acids 1-43PromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralTagsExpressionMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
AsCas12a-2C-NLS in pCSDest
Plasmid#126637PurposeExpresses AsCas12a-2C-NLS in mammalian cellsDepositorInsertAsCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianMutationPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterTagsExpressionMutationPromoterAvailable sinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-luciferase
Plasmid#113353Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1
Plasmid#83569PurposeExpresses TET1 with a mutated catalytic domain in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationcatalytic domain mutant H1672D, D1674APromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only