We narrowed to 31,400 results for: Eng
-
Plasmid#50295DepositorInsert5'UTR, omega (Tobacco Mosaic Virus) + mitochondrial localisation signal ScCoxIV (Saccharomyces cerevisiae)
UsePlant expressionTagsExpressionMutationBsaI/BbsI sites removed by point-mutationPromoterAvailable sinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICH45195
Plasmid#50275DepositorInsertpromoter + 5' UTR, RbcS2B (AT5g38420, A. thaliana)
UsePlant expressionTagsExpressionMutationBsaI/BbsI sites removed by point-mutationPromoterAvailable sinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICH85281
Plasmid#50272DepositorInsertPromoter + 5'UTR, mas, (A. tumefaciens) + 5'UTR, omega (Tobacco Mosaic Virus)
UsePlant expressionTagsExpressionMutationBsaI/BbsI sites removed by point-mutationPromoterAvailable sinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGM5343
Plasmid#50297DepositorInsert5'UTR, omega (Tobacco Mosaic Virus) + signal peptide, RAmy3A (O. sativa) + HIS tag
UsePlant expressionTagsExpressionMutationBsaI/BbsI sites removed by point-mutationPromoterAvailable sinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT01
Plasmid#223373PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT02
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-mir1-8mer4x (pEZ184)
Plasmid#229058PurposeDual-luciferase reporter containing 4 copies of the 8mer site of human miR-1DepositorInsertHuman miR-1 binding sites
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI5-CasRx-HA (pKW88)
Plasmid#229046PurposeMammalian expression of CasRx-HADepositorInsertCasRx (RfxCas13d)
UseCRISPRTagsHAExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET29_anti-MERS-Nanobody-VHH-55
Plasmid#209417PurposeExpress anti-MERS-Nanobody-VHH-55 in E. coliDepositorInsertanti-mers-nanobody-vhh-55
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-83
Plasmid#209418Purposeexpress anti-MERS-Nanobody-VHH-83 in E. coliDepositorInsertanti-mers-nanobody-vhh-83
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-84
Plasmid#209419PurposeExpress anti-MERS-Nanobody-VHH-84 in E. coliDepositorInsertanti-mers-nanobody-vhh-83
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-1
Plasmid#206890PurposeExpress anti-MERS-Nanobody-VHH-1 in E. coliDepositorInsertanti-mers-nanobody-vhh-1
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOSV00157
Plasmid#222937PurposeKill switch plasmid for DNA sensor construction using Bacillus subtilisDepositorInsertTxpA-RatA toxin-antitoxin
UseTagsExpressionBacterialMutationPromoterPhyperspankAvailable sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP H2B SL2
Plasmid#227718PurposePlasmid contains GFP H2B SL2, with some nlp-51 homology sequence after, Amp ResistantDepositorInsertGFP H2B SL2 (nlp-51 Nematode)
UseCloning vectorTagsExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
SL2 GFP H2B
Plasmid#227717PurposePlasmid contains SL2 GFP H2B, with some nlp-51 homology sequence before, Amp ResistantDepositorInsertSL2 GFP H2B (nlp-51 Nematode)
UseCloning vectorTagsExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorInsertLUG1 gRNA (YLR352W Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only