We narrowed to 8,876 results for: sgrna
-
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1a/hU6Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgGFP
Plasmid#190899PurposeAAV vector expressing sgGFPDepositorInsertsgRNA
UseAAV and CRISPRPromoterU6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-doraWT_rescue_construct
Plasmid#190608PurposePuromycin-selectable expression of HA-tagged Dora (CG34401) in Drosophila S2 cellsDepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA2963_eSpCas9-PGKHygdtkCh
Plasmid#124205PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF712
Plasmid#121663PurposeU6-sgRNA EF1a-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-compact
Plasmid#99369PurposeExpresses Cas9-Nlux and sgRNA. Contains CEN/ARS. No selection marker.DepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0075
Plasmid#117642PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SaCas9(pEPOR1CB0015) and sgRNA_Flavin-binding monooxygenase family protein {AT1G62600}(pEPOR1CB0098)and sgRNA_Flavin-binding monooxygenase family protein {AT1G62590}(pEPOR1CB0109)DepositorInsert[35S:SaCas9(pEPOR1CB0015) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN220
Plasmid#91681PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN221
Plasmid#91682PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN154
Plasmid#91683PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas59
Plasmid#82396PurposesgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas45
Plasmid#82390PurposesgRNA targeting YFP with additional bases 5' end like pCas34, but from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas57
Plasmid#82395PurposesgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas56
Plasmid#82394PurposesgRNA targeting YFP +46 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas55
Plasmid#82393PurposesgRNA targeting YFP +172 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas52
Plasmid#82392PurposesgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas15
Plasmid#82383PurposesgRNA targeting YFP (truncated to 18 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas14
Plasmid#82382PurposesgRNA targeting YFP (truncated to 15 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas13
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRia-v2
Plasmid#84832PurposeCRISPRi/a V2 library parental plasmidDepositorInsertssgRNA
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32
Plasmid#63142PurposeExpress sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated transformation.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 promoter for gRNA/PTG expression a…Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only