We narrowed to 19,393 results for: IRE
-
Plasmid#128709PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopE1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5617
Plasmid#128706PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopB1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA9-Pct5-DadhABC(A2)
Plasmid#191632PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-ExSYTE
Plasmid#216263PurposeCre-dependent expressoin of ExSYTE (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDUP1
Plasmid#223516Purposeinactive cogfp under control of Ptet, cogfp under control of PtacDepositorInsertsCoGFP
CoGFP inactivated
TagsHis tagExpressionBacterialMutationanti-dimerization mutations S129G, 22 C154S, D156…PromoterPtac, Ptac and Ptet, and PtetAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJAF215
Plasmid#52402PurposeExpresses Flag-tagged mouse Arf1DepositorAvailable SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5myc Rac1 wt
Plasmid#37030DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUWR-CadTS-C
Plasmid#58326PurposeDestination vector for inserting ubi-CadTS control to Drosophila melanogaster genomeDepositorInsertE-cadherin tension sensor control
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCPP5588
Plasmid#128708PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopD1
ExpressionBacterialAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPP5053
Plasmid#128707PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopC1
ExpressionBacterialAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPP5530
Plasmid#128705PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopA1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CIBN-CAAX
Plasmid#188989PurposeA lentiviral plasmid encoding plasma membrane-tagged CIBNDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCit-APPAP-gs
Plasmid#228090PurposeMammalian expression of five coiled coil segments in APPAP arrangment, with short flexible linkers and N-terminal mCitrine; for phase separation and forming of liquid condensates in mammalian cells.DepositorInsertmCit, APPAP
ExpressionMammalianAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK B
Plasmid#37018DepositorAvailable SinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag-Pcbp2
Plasmid#184028PurposeCodon optimized Pcbp2 clone with N-terminal flag tagDepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCPP3417
Plasmid#128724PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopY1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-26
Plasmid#172751PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-26; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-26
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
C1-FT-mCitrine-EAAARx8-CaaX
Plasmid#155224PurposeMPAct with increased search radiusDepositorInsertF-tractin (aa9-52 of rat ITPKA) fused to mCitrine C-term tagged with codon optimized (EAAAR)x8 and CaaX seq derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Dicer2
Plasmid#14764DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-11
Plasmid#172762PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-11; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-11
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_1
Plasmid#106316PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM160
Plasmid#134169PurposeBacterial expression of RB3 stathmin-like domain (SLD)DepositorAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE puro Brca1 S1423A S1524A HA
Plasmid#41968DepositorAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Pou4f3
Plasmid#158530PurposeExpresses human Pou4f3 in mammalian cellsDepositorAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXL flag Smad3
Plasmid#10920DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-mir124a
Plasmid#61539PurposeExpresses mir124a in mammalian cellsDepositorAvailable SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-hsDicer (K70A)
Plasmid#41589DepositorAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Drosha2
Plasmid#14767DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-TetR-KRf-TetR
Plasmid#216270PurposeConstruct 3: TetR - Lipid binding domain KRφ - TetRDepositorInsertTetR - Lipid binding motif (KRf) - TetR
TagsEGFPExpressionMammalianAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET14b PHAS-I
Plasmid#15679DepositorInsertPHAS-I (Eif4ebp1 Rat)
Tags6xHisExpressionBacterialMutationNucleotides 1-354 of rat PHAS-I plus 450bp of 3…Available SinceSept. 24, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse DGCR8-1
Plasmid#14772DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-His-TEV-OTC_Ub
Plasmid#172134PurposeScaffold design for studying ubiquitin interacting proteins by cryo-EM.DepositorInsertE. coli ornithine transcarbamylase (OTC), fused to human ubiquitin
Tags6xHis-TEVExpressionBacterialPromoterT7Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-PHLPP1(N-terminal truncation)-deltaC
Plasmid#22931PurposeMammalian expression of a HA tagged, N-terminal truncation of human PHLPP1 containing a deletion of the PDZ binding motif (delta C)DepositorInsertPHLPP1-deltaC (PHLPP1 Human)
TagsHAExpressionMammalianMutationPHLPP-deltaC, deletion of PDZ binding domain--the…PromoterCMVAvailable SinceFeb. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Zyxin-Full Length (aa1-564)-EGFP
Plasmid#187692PurposeVisualization of ZyxinDepositorAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag6-iCAM-1
Plasmid#205210PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG6DepositorInsertsynCAM iCAM1 and Lag6 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag18-iCAM-1
Plasmid#205207PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG18DepositorInsertsynCAM iCAM1 and Lag18 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag42-iCAM-1
Plasmid#205205PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG42DepositorInsertsynCAM iCAM1 and Lag42 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL0426 (CRISPR with spc3)
Plasmid#130642PurposeExpresses CRISPR RNA from a T7 promoter for VchCAST system. The CRISPR array encodes a guide RNA with spacer 3 from the native CRISPR.DepositorInsertCRISPR(spacer-3)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-DUET-GST-eIF4G1-His6, eIF4E
Plasmid#37232DepositorTagsGST and His6ExpressionBacterialPromoterT7Available SinceSept. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsXRN1_1-1173_K
Plasmid#146785PurposeMammalian Expression of HsXRN1_1-1173DepositorInsertHsXRN1_1-1173 (XRN1 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-1
Plasmid#172767PurposeBacterial expression of anti-mCherry nanobody LaM-1, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-1
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWL89A mmPing20
Plasmid#145788PurposemPing Yeast Transposition AssayDepositorInsertmmPing20
ExpressionYeastMutationT162C, T258A, T287C, T300A, T304A, T310A, G372AAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBEAST-pBen-Luc
Plasmid#122694PurposeOutput expression of firefly luciferase under the activation of BenR transcription factor for cell-free expressionDepositorInsertFirefly luciferase
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3XFLAG-MKL1-~100
Plasmid#27176DepositorAvailable SinceDec. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-21
Plasmid#172749PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-21; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-21
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-37
Plasmid#172756PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-37; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-37
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3/hArf3(WT)-EGFP
Plasmid#79418PurposeExpresses C-terminally EGFP-tagged Arf3(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3/hArf1(WT)-EGFP
Plasmid#79413PurposeExpresses C-terminally EGFP-tagged Arf1(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRG36-ChAT
Plasmid#99069PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea ChAT (choline acetyltransferase)DepositorInsertChAT (choline acetyltransferase) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only