We narrowed to 31,602 results for: REP
-
-
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-RsACR_995-EYFP
Plasmid#103772PurposeAnion channelrhodopsin from Rhodomonas salina (CCMP1319) for expression in mammalian cellsDepositorInsertAnion channelrhodopsin RsACR_995
TagsEYFPExpressionMammalianMutationhuman codon optimizedPromoterCMVAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GcACR_457-EYFP
Plasmid#103137PurposeAnion channelrhodopsin from Geminigera cryophila (CCMP2564) for expression in mammalian cellsDepositorInsertAnion channelrhodopsin GcACR_457
TagsEYFPExpressionMammalianMutationhuman codon optimizedPromoterCMVAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shMePCE
Plasmid#113536PurposeRetroviral vector designed to knock down MePCE.DepositorInsertshMePCE (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
mVenus-C1-GEFT
Plasmid#84340PurposeExpresses p63 (474 a.a.) tagged with mVenusDepositorAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-R1ACR_741-EYFP
Plasmid#103961PurposeHighly efficient anion channelrhodopsin from Rhodomonas sp. (CCMP768) for expression in mammalian cellsDepositorInsertAnion channelrhodopsin R1ACR_741
TagsEYFPExpressionMammalianMutationhuman codon optimizedPromoterCMVAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
vsv-Sgo1 N61I-GFP
Plasmid#108497Purposeexpression of vsv-Sgo1 N61I-EGFP (no PP2A binding)DepositorInsertShugoshin 1 (SGO1 Human)
TagsEGFP and VSVExpressionMammalianMutationno PP2A binding N61IPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
p.UTA.2.0 miR 19b-3p
Plasmid#82442PurposeDual Fluorescent endogenous miRNA sensor. Perfect complementary region of hsa-miR-19b-3pDepositorInserthsa-miR-19-3p
MutationComplementary region for hsa-miR-19-3p as sensorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(C8C9- SS)-GFP
Plasmid#246842PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with C8C9-SS mutationDepositorInsertArl13B (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationchanged Cysteine 8 and 9 to SerineAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-GFP(1-245)
Plasmid#246847PurposeExpress Arl13B (resistance to sgRNA), aa1-245, tagged with GFPDepositorInsertArl13B (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationdeleted amino acids 246-428Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_tnnt2a_cmlc2-nmKate
Plasmid#238309PurposeDrives expression of 3 different gRNAs targeting tnnt2a, and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHD Btl-pYtag(Scarlet) ScarlessDsRed
Plasmid#244937PurposeVector for tagging Breathless (Btl) with Scarlet-based pYtag biosensor. DsRed marker.DepositorInsertmScarlet-tagged pYtag system (3xITAM P2A mScarlet-ZtSH2)
UseEndogenous taggingAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Torso
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSE89: pFuGW-G5p-EYFP
Plasmid#240461PurposeSynthetic GAL4p comprising 5 tandem GAL4 binding sites (G5p) regulating EYFPDepositorInsertsG5p
EYFP
UseLentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSE92: pFuGW-G14p-EYFP
Plasmid#240462PurposeA synthetic GAL4 promoter comprising 14 tandem GAL4 binding sites (G14p) regulating EYFPDepositorInsertsEYFP
G14p
UseLentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-FERM (Myo10)
Plasmid#145140PurposeExpresses EGFP-tagged MyTH/FERM domains of MYO10.DepositorInsertMyTH/FERM domains of MYO10 (MYO10 Human)
ExpressionMammalianAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only