173,387 results
-
Plasmid#200814Purposeexpresses BubR1 in mammalian cellsDepositorInsertBUB1 mitotic checkpoint serine/threonine kinase B (BUB1B Human)
TagsFLAGExpressionMammalianPromoterCAGAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKSEe401R
Plasmid#218532PurposeCRISPR/Cas9 genome editing vector pKSEe401R contains the maize codon-optimized Cas9 (zCas9) enhanced by the 5′-UTR fragment of OsMac3 and the pAtUBQ10-DsRED1-NOSt screening cassette in the backbone.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
hU6-DR_BsmBI_DR-EFS-RfxCas13d-NLS-2A-Puro-WPRE CasRx pre-gRNA backbone
Plasmid#219823PurposeEF1α-driven expression of RfxCas13d in mammalian cells. For cloning of pre-guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. (Adapted from plasmid #138147)DepositorInsertRfxCas13d
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core promoterAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-YopE
Plasmid#221328PurposeDox-inducible expression of YopE in mammalian cells by retroviral transductionDepositorInsertYopE
UseRetroviralTagsFLAGPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN-X-A-ccdB-G-Z
Plasmid#218892Purposegolden gate cloningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRA101
Plasmid#209335PurposeGateway cloning compatible binary vector for agrobacterium mediated transformation. Arabidopsis UBQ10 promoter expression of N-terminal mVenus fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI pHluorin Syt3
Plasmid#184504PurposeMammalian expression of Synaptotagmin 3 with pH-sensitive fluorescent proteinDepositorAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
FDA60
Plasmid#45606DepositorInsertFDA60
Tags6xHisExpressionBacterialAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNAGuide_003
Plasmid#192505PurposeFor cloning of guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat and smRNA, evopreQ1, capture sequences and GFPDepositorInserthU6-RfxCas13d-DR1-BsmBI-DR-smRNA-SapI-CS1-evopreQ1-EFS-EGFP-2A-Puro-WPRE
UseLentiviralPromoterhU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-Rab7
Plasmid#129603PurposeIn vivo visualization of Rab7 (can be used for colocalization studies)DepositorInsertRab7
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-mCherry
Plasmid#75161PurposeDerived from LentiCRISPR v1 but expresses mCherry instead of puromycin resistance. 3rd generation.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsmCherryExpressionMammalianAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-vCre (AAV Retrograde)
Viral Prep#55638-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-EF1a-vCre (#55638). In addition to the viral particles, you will also receive purified pAAV-EF1a-vCre plasmid DNA. EF1a-driven expression of VCre. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-His-TEV-NQO1
Plasmid#119058PurposeFor expression in E.coli and affinity purification of N-terminally His tagged NQO1DepositorInsertNAD(P)H dehydrogenase, quinone 1 (NQO1) (NQO1 Human)
Tags6His, TEV siteExpressionBacterialPromoterT7Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPaint Gene Tagging Kit
Plasmid Kit#1000000086PurposeCRISPR-assisted insertion tagging (CRISPaint) plasmid collection for modular integration of large DNA fragments into user-defined genomic locations via a ligase-4-dependent mechanism.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeCRISPRAvailable SinceSept. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pLminP_Luc2P_RE16
Plasmid#90357PurposeCREB - Cyclic AMP gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterCREBAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
VP12
Plasmid#72247PurposeHuman expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A and Q926APromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH-Halo tag
Plasmid#154144PurposeGateway compatible mammalian expression plasmid for halo tag fusion proteinsDepositorTypeEmpty backboneTagsHalo tagExpressionMammalianAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-TO-hNGN2-BSD-mApple
Plasmid#124229PurposeTargets the human CLYBL safe harbor locus for integration of dox-inducible NGN2 for differentiation of iPSCs into cortical neurons. Contains a floxed BSD-NLS-mApple selection cassette.DepositorInsertNGN2 (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA_mIGg2a_Anti-HA [12CA5] v2
Plasmid#236295PurposeMammalian vector expressing Anti-HA [12CA5] variable region fused to mouse IgG2a heavy chain; to be used with pcDNA_mK_Anti-HA [12CA5] v2 light chain (Plasmid 236296) to make the antibody.DepositorInsertAnti-HA [12CA5] heavy chain variable region fused to mouse IgG2a heavy chain
TagsMouse IgG2a FcExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA_mK_Anti-HA [12CA5] v2
Plasmid#236296PurposeMammalian vector expressing Anti-HA [12CA5] variable region fused to mouse Kappa light chain; to be used with pcDNA_mIGg2a_Anti-HA [12CA5] v2 heavy chain (Plasmid 236295) to make the antibody.DepositorInsertAnti-HA [12CA5] light chain variable region fused to mouse kappa light chain
ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hAAVS1 TALEN Right
Plasmid#52342PurposeTALEN vector for genomic targetingDepositorInsertAAVS1 TALEN Right
ExpressionMammalianPromoterCMVAvailable SinceJuly 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Orai1
Plasmid#21638DepositorAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
BFP-Sec61 beta
Plasmid#49154Purposeexpression of Sec61 beta fused to TagBFP, used as a general ER markerDepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMito-miRFP703
Plasmid#80000PurposeMitochondria labeling with near-infrared fluorescent protein miRFP703DepositorInsertcytochrome C oxidase subunit VIII (COX8A Human)
TagsmiRFP703ExpressionMammalianPromoterCMVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-flag YAP2 5SA
Plasmid#27371DepositorInsertYAP2 (YAP1 Human)
TagsflagExpressionMammalianMutationSerines at positions 61, 109, 127, 128, 131, 163,…Available SinceFeb. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.1-mIglc2
Plasmid#127156PurposeExpression of immunoglobulin light chains in mammalian cells, mouse (C57BL/6), lambda 2 constant regionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 p53 WT
Plasmid#69003Purposemammalian expression of wild type human p53DepositorAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Rab5DN(S34N)
Plasmid#35139DepositorInsertRab5a (RAB5A Human)
TagsmCherryExpressionMammalianMutationDominant Negative- S34NPromoterCMVAvailable SinceMarch 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC10-pA
Plasmid#220774PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC10
UseAAVPromoterCAGAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-oScarlet-WPRE-BC8-pA
Plasmid#220772PurposeExpression of oScarlet for cell isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertoScarlert-WPRE-BC8
UseAAVPromoterCAGAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC3-pA
Plasmid#220755PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC3
UseAAVPromoterCAGAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHL-FcHis
Plasmid#99846Purposemammalian expression with secretive signal and FC tagDepositorAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213656-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pMo130-TelR
Plasmid#50799PurposeSuicide vector for generating chromosomal deletions in multidrug-resistant bacteriaDepositorInserttellurite-resistance cassette
UseSuicide vectorPromoterPCs12Available SinceMarch 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21a-Streptavidin-Alive
Plasmid#20860PurposeAlive subunit for creating monovalent streptavidin with a single femtomolar biotin binding site. Can also be used to create wild-type (tetravalent) streptavidin.DepositorInsertStreptavidin-Alive
TagsHisExpressionBacterialMutationWt geneAvailable SinceApril 21, 2009AvailabilityAcademic Institutions and Nonprofits only