We narrowed to 15,163 results for: GRN
-
Plasmid#107274PurposeAPRT sgRNA-2 and Cas9 expression vectorDepositorInsertAPRT sgRNA-2
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SpCas9
Plasmid#107328PurposeU6 driven SpCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_NmCas9
Plasmid#107329PurposeU6 driven NmCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-2
Plasmid#210130Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-1
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-CDS
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH85
Plasmid#128198Purposeclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH86
Plasmid#128199Purposeimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN1
Plasmid#125771Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN1 (WRN Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN2
Plasmid#125772Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN2 (WRN Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-1
Plasmid#51584PurposeshRNA 1 against rodent Rem2DepositorAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
ZO-1 shRNA 2968
Plasmid#37208DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP X2/pTER shLUC (w454-1)
Plasmid#17491PurposeRetroviral Luciferase shRNA (H1/TO promoter), 3’LTR insertion, PuroDepositorInsertFirefly Luciferase shRNA
UseRNAi and RetroviralAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp KI;Empty
Plasmid#240302PurposeEmpty vectorDepositorInsertEmpty gRNA
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
phU6 ST
Plasmid#188712PurposesgRNA plasmid encoding hU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 ST
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP2824
Plasmid#160671PurposeMobile CRISPRi sfGFP 'test', empty sgRNADepositorInsertempty sgRNA (BsaI)
ExpressionBacterialAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1344
Plasmid#119273Purposeknockdown folA in E. aerogenesDepositorInsertsgRNA folA (E. aerogenes)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1239
Plasmid#119263Purposeknockdown folA in P. aeruginosaDepositorInsertsgRNA folA (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas5
Plasmid#82378PurposesgRNA targeting YFP expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pplss-mRFP-KDEL-pcDNA3.1/Hygro
Plasmid#242808PurposeER markerDepositorInsertmRFP with ER targeting signal sequence and C-terminal KDEL-ER retention signal
ExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT449
Plasmid#139389PurposeBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT448
Plasmid#139388PurposeBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1),
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT492
Plasmid#139397PurposeBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnxABE-flgn
Plasmid#187932PurposeA-to-G base editorDepositorInsertecTadA(8e)-nxCas9 (D10A)
UseCRISPRExpressionBacterialAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS3
Plasmid#140626PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS3. The crRNA-IS3 targets IS3 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS3
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-Cre2GO
Plasmid#136907PurposeLentivirus for base editing activatable Cre recombinase expression in mammalian cells. All in one vector with sgCre2GO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-1
Plasmid#136046PurposeSMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-2
Plasmid#136047PurposeSMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPU-Empty-miR30-L1221
Plasmid#132940PurposeAll-in-one control rescue-control shRNA knockdown vectorDepositorInsertGFP
UseLentiviral and RNAiTagsHAExpressionMammalianPromoterSFFVAvailable SinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pABM-D4-miR30-CypA
Plasmid#132934PurposeLentivector for CypA knockdown and blasticidin resistanceDepositorInsertCypA shRNA
UseLentiviral and RNAiPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pABM-D4-miR30-L1221
Plasmid#132933PurposeLentivector for luciferase (control) knockdown and blasticidin resistanceDepositorInsertluciferase shRNA
UseLentiviral and RNAiPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-STAT1
Plasmid#117160PurposeTarget site ATATCCAGTTCCTTTAGGGCCDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF9
Plasmid#117159PurposeTarget site AATTATCACAAAGAGGACAGGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF3
Plasmid#101336Purposetarget site ATCAGATCTACAATGAAGGGCDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_sgACTA2
Plasmid#63712PurposeExpress sgACTA2 in mammalian cells.DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper 44-1
Plasmid#51597PurposeshRNA 1 against rat and mouse Sema4DDepositorInsertshRNA1
UseRNAiPromoterU6Available SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only